National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4633R-4 
 Symbol Aats-ala-m  Full Name mitochondrial alanyl-tRNA synthetase 
 CG No CG4633  Old CG No CG4633 
 Synonyms Dm mt AlaRS, CG4633, AlaS, Aats-ala-m 
 Accession No (Link to NCBI) NM_079208.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Arsham AM, Neufeld TP.
A genetic screen in Drosophila reveals novel cytoprotective functions of the autophagy-lysosome pathway.
PLoS ONE (2009) 4(6) e6068 [ PubMed ID = 19562034 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCTGACAGCGCGCGAGATTCGTAAAACCTTTTTGGATCATTTCACCGTCAATCATGGCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     61  ACAAGTTCGTTCGCTCCAGCCCGGTGGTGCCCTTTTGCGATCCCACTGTGGCTTTCGTTA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACGCGGGCATGAATCAGTTCAAGTCGGTGTTCCTGGGCACAGCAGCGGCGCCACACAAGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGGTTGTCAACTCCCAGAAGTGCGTCCGCGTTGGGGGAAAGCACAATGATCTCTCCGTGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGGGCACGGATGGCTATCATCACACGTTCTTTGAGATGCTGGGCAACTGGTCCTTTGGGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATTACTTCAAGCGGGAGGCGTGTGCAATGGCCCTGGAGCTGCTCCGTGGTCCCTACAACA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTGATCCAGGTCGTCTATACGTCACATACTTTGCTGGCGACAAGGTGCTGGGCATTCCAG 420

                          |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| silico     421 CCGATCTGGAGTGTTTCGAGATCTGGAGGAGCCTGGGCTTTCCCGCCTCGCGAATACTGC 480

4633R-4.IR_full       481 CCTTTGGCTGCGCCGACAAT 500
                          |||||||||||||||||||| silico     481 CCTTTGGCTGCGCCGACAAT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0.2   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0.2   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0.2   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   13  37  19  NM_205934.1  CG13391-RB, transcript variant B (Aats-ala), mRNA 
0   13  37  19  NM_078787.2  CG13391-RA, transcript variant A (Aats-ala), mRNA 
0   NM_167241.1  CG1799-RC, transcript variant C (ras), mRNA 
0   NM_167240.1  CG1799-RA, transcript variant A (ras), mRNA 
0   NM_079907.4  CG1799-RB, transcript variant B (ras), mRNA 
0   NM_079351.2  CG17166-RA (mRpL39), mRNA 
0   NM_130668.2  CG2694-RB, transcript variant B (CG2694), mRNA 
0   NM_166949.1  CG2694-RA, transcript variant A (CG2694), mRNA 
0   NM_138126.1  CG3611-RA (CG3611), mRNA 
0   NM_130503.2  CG13360-RA (CG13360), mRNA 
0   NM_079468.2  CG10582-RA (Sin), mRNA 
0   10  NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   10  NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   10  NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   10  NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   10  NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_176444.1  CG33208-RB, transcript variant B (MICAL), mRNA 
0   NM_170034.1  CG4919-RA (Gclm), mRNA 
0   NM_135738.2  CG6167-RA, transcript variant A (PICK1), mRNA 
0   NM_165018.1  CG6167-RB, transcript variant B (PICK1), mRNA 
0   NM_176443.1  CG33208-RE, transcript variant E (MICAL), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_141000.1  CG3698-RA (CG3698), mRNA 
0   NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_140650.2  CG18217-RA (CG18217), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.