National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4633R-2 
 Symbol Aats-ala-m  Full Name mitochondrial alanyl-tRNA synthetase 
 CG No CG4633  Old CG No CG4633 
 Synonyms Dm mt AlaRS, CG4633, AlaS, Aats-ala-m 
 Accession No (Link to NCBI) NM_079208.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Arsham AM, Neufeld TP.
A genetic screen in Drosophila reveals novel cytoprotective functions of the autophagy-lysosome pathway.
PLoS ONE (2009) 4(6) e6068 [ PubMed ID = 19562034 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCTGACAGCGCGCGAGATTC 
 Primer Seq. 3'
aatctagaggtaccATTGTCGGCGCAGCCAAAGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCTGACAGC GCGCGAGATT CGTAAAACCT TTTTGGATCA TTTCACCGTC AATCATGGCC 
0061 ACAAGTTCGT TCGCTCCAGC CCGGTGGTGC CCTTTTGCGA TCCCACCGTG GCTTTCGTTA 
0121 ACGCGGGCAT GAATCAGTTC AAGTCGGTGT TCCTGGGCAC AGCAGCGGCG CCACACAAGC 
0181 GGGTTGTCAA CTCCCAGAAG TGCGTCCGCG TTGGGGGAAA GCACAATGAT CTCTCCGTGG 
0241 TGGGCACGGA TGGCTATCAT CACACGTTCT TTGAGATGCT GGGCAACTGG TCCTTTGGGG 
0301 ATTACTTCAA GCGGGAGGCG TGTGCAATGG CCCTGGAGCT GCTCCGTGGT CCCTACAACA 
0361 TTGATCCAGG TCGTCTATAC GTCACATACT TTGCTGGCGA CAAGGTGCTG GGCATTCCAG 
0421 CCGATCTGGA GTGTTTCGAG ATCTGGAGGA GCATGGGATT TCCCGCCTCG CGAATACTGC 
0481 CCTTTgGCTG CGCCGACAAT  
 in silico PCR Fragment
0001 TGCTGACAGC GCGCGAGATT CGTAAAACCT TTTTGGATCA TTTCACCGTC AATCATGGCC 
0061 ACAAGTTCGT TCGCTCCAGC CCGGTGGTGC CCTTTTGCGA TCCCACTGTG GCTTTCGTTA 
0121 ACGCGGGCAT GAATCAGTTC AAGTCGGTGT TCCTGGGCAC AGCAGCGGCG CCACACAAGC 
0181 GGGTTGTCAA CTCCCAGAAG TGCGTCCGCG TTGGGGGAAA GCACAATGAT CTCTCCGTGG 
0241 TGGGCACGGA TGGCTATCAT CACACGTTCT TTGAGATGCT GGGCAACTGG TCCTTTGGGG 
0301 ATTACTTCAA GCGGGAGGCG TGTGCAATGG CCCTGGAGCT GCTCCGTGGT CCCTACAACA 
0361 TTGATCCAGG TCGTCTATAC GTCACATACT TTGCTGGCGA CAAGGTGCTG GGCATTCCAG 
0421 CCGATCTGGA GTGTTTCGAG ATCTGGAGGA GCCTGGGCTT TCCCGCCTCG CGAATACTGC 
0481 CCTTTGGCTG CGCCGACAAT  
 Assemble Data

4633R-2.IR_full       1   TGCTGACAGCGCGCGAGATTCGTAAAACCTTTTTGGATCATTTCACCGTCAATCATGGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4633R-2.in silico     1   TGCTGACAGCGCGCGAGATTCGTAAAACCTTTTTGGATCATTTCACCGTCAATCATGGCC 60


4633R-2.IR_full       61  ACAAGTTCGTTCGCTCCAGCCCGGTGGTGCCCTTTTGCGATCCCACCGTGGCTTTCGTTA 120
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
4633R-2.in silico     61  ACAAGTTCGTTCGCTCCAGCCCGGTGGTGCCCTTTTGCGATCCCACTGTGGCTTTCGTTA 120


4633R-2.IR_full       121 ACGCGGGCATGAATCAGTTCAAGTCGGTGTTCCTGGGCACAGCAGCGGCGCCACACAAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4633R-2.in silico     121 ACGCGGGCATGAATCAGTTCAAGTCGGTGTTCCTGGGCACAGCAGCGGCGCCACACAAGC 180


4633R-2.IR_full       181 GGGTTGTCAACTCCCAGAAGTGCGTCCGCGTTGGGGGAAAGCACAATGATCTCTCCGTGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4633R-2.in silico     181 GGGTTGTCAACTCCCAGAAGTGCGTCCGCGTTGGGGGAAAGCACAATGATCTCTCCGTGG 240


4633R-2.IR_full       241 TGGGCACGGATGGCTATCATCACACGTTCTTTGAGATGCTGGGCAACTGGTCCTTTGGGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4633R-2.in silico     241 TGGGCACGGATGGCTATCATCACACGTTCTTTGAGATGCTGGGCAACTGGTCCTTTGGGG 300


4633R-2.IR_full       301 ATTACTTCAAGCGGGAGGCGTGTGCAATGGCCCTGGAGCTGCTCCGTGGTCCCTACAACA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4633R-2.in silico     301 ATTACTTCAAGCGGGAGGCGTGTGCAATGGCCCTGGAGCTGCTCCGTGGTCCCTACAACA 360


4633R-2.IR_full       361 TTGATCCAGGTCGTCTATACGTCACATACTTTGCTGGCGACAAGGTGCTGGGCATTCCAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4633R-2.in silico     361 TTGATCCAGGTCGTCTATACGTCACATACTTTGCTGGCGACAAGGTGCTGGGCATTCCAG 420


4633R-2.IR_full       421 CCGATCTGGAGTGTTTCGAGATCTGGAGGAGCATGGGATTTCCCGCCTCGCGAATACTGC 480
                          |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||
4633R-2.in silico     421 CCGATCTGGAGTGTTTCGAGATCTGGAGGAGCCTGGGCTTTCCCGCCTCGCGAATACTGC 480


4633R-2.IR_full       481 CCTTTGGCTGCGCCGACAAT 500
                          ||||||||||||||||||||
4633R-2.in silico     481 CCTTTGGCTGCGCCGACAAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0.2   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0.2   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0.2   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   13  37  19  NM_205934.1  CG13391-RB, transcript variant B (Aats-ala), mRNA 
0   13  37  19  NM_078787.2  CG13391-RA, transcript variant A (Aats-ala), mRNA 
0   NM_167241.1  CG1799-RC, transcript variant C (ras), mRNA 
0   NM_167240.1  CG1799-RA, transcript variant A (ras), mRNA 
0   NM_079907.4  CG1799-RB, transcript variant B (ras), mRNA 
0   NM_079351.2  CG17166-RA (mRpL39), mRNA 
0   NM_130668.2  CG2694-RB, transcript variant B (CG2694), mRNA 
0   NM_166949.1  CG2694-RA, transcript variant A (CG2694), mRNA 
0   NM_138126.1  CG3611-RA (CG3611), mRNA 
0   NM_130503.2  CG13360-RA (CG13360), mRNA 
0   NM_079468.2  CG10582-RA (Sin), mRNA 
0   10  NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   10  NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   10  NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   10  NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   10  NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_176444.1  CG33208-RB, transcript variant B (MICAL), mRNA 
0   NM_170034.1  CG4919-RA (Gclm), mRNA 
0   NM_135738.2  CG6167-RA, transcript variant A (PICK1), mRNA 
0   NM_165018.1  CG6167-RB, transcript variant B (PICK1), mRNA 
0   NM_176443.1  CG33208-RE, transcript variant E (MICAL), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_141000.1  CG3698-RA (CG3698), mRNA 
0   NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_140650.2  CG18217-RA (CG18217), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.