National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4623R-3 
 Symbol CG4623  Full Name CG4623 
 CG No CG4623  Old CG No CG4623 
 Synonyms CG4623 
 Accession No (Link to NCBI) NM_139688.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTTCAAGGCTCCCGATCTGC 
 Primer Seq. 3'
aatctagaggtaccTTTGGTCGCCTGTTCGTCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTTCAAGGC TCCCGATCTG CCGGCCAATA AGCCAGTGCT CTTCTTCCAT CCGTACAACT 
0061 TCCATGCGCA AAAAGTTCTT ATGGTCTTCT ACGAGAAGAA GATCGACTTC TTTCCCTATG 
0121 TGGTGGACCT GTGCAATGGC GAGCAGTACT CCAATTGGTT CCTAAACCTC AATCCCAAGG 
0181 GCGATGTGCC AGTGCTCCAG GATGGCGCCC TCGTCATTCC CAGCTCGACG CACATCATCA 
0241 ACTATGTGGA GAGCAAATTT CGCGGTGATC GATCGCTGAA NGCCAGCGCA CAACTCCAAG 
0301 GAATTCGATC AGATGCTGGT CTTCGAGCAG GCAATGGCCC GCCTTCCGGT GGGAACACTC 
0361 AGCCTGGGCT CCTTCATACA CGACGATCTG AAGCTGGTGC CCAAGGCGCC CTNTCATCGG 
0421 ACCCGTGCGC CAGTCCTGCC TGAAAAACAA TGAAAAGGTG CTGGATCTGC TGCGCCACTC 
0481 GGTGGACGAA cAGGCGACCA AA 
 in silico PCR Fragment
0001 ACTTCAAGGC TCCCGATCTG CCGGCCAATA AGCCAGTGCT CTTCTTCCAT CCGTACAACT 
0061 TCCATGCGCA AAAAGTTCTT ATGGTCTTCT ACGAGAAGAA GATCGACTTC TTTCCCTATG 
0121 TGGTGGACCT GTGCAATGGC GAGCAGTACT CCAATTGGTT CCTAAACCTC AATCCCAAGG 
0181 GCGATGTGCC AGTGCTCCAG GATGGCGCCC TCGTCATTCC CAGCTCGACG CACATCATCA 
0241 ACTATGTGGA GAGCAAATTT CGCGGTGATC GATCGCTGAA -GCCAGCGCA CAACTCCAAG 
0301 GAATTCGATC AAATGCTGAT CTTCGAGCAG GCAATGGCCC GCCTTCCAGT GGGAACACTC 
0361 AGCCTGGGCT CCTTCATACA CGACGATCTG AAGCTGGTGC CCAAGGCGCC CT-TCATCGG 
0421 ACCCGTGCGC CAGTCCTGCC TGAAAAACAA TGAAAAGGTG CTGGATCTGC TGCGCCACTC 
0481 GGTGGACGAA CAGGCGACCA AA 
 Assemble Data

4623R-3.IR_full       1   ACTTCAAGGCTCCCGATCTGCCGGCCAATAAGCCAGTGCTCTTCTTCCATCCGTACAACT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4623R-3.in silico     1   ACTTCAAGGCTCCCGATCTGCCGGCCAATAAGCCAGTGCTCTTCTTCCATCCGTACAACT 60


4623R-3.IR_full       61  TCCATGCGCAAAAAGTTCTTATGGTCTTCTACGAGAAGAAGATCGACTTCTTTCCCTATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4623R-3.in silico     61  TCCATGCGCAAAAAGTTCTTATGGTCTTCTACGAGAAGAAGATCGACTTCTTTCCCTATG 120


4623R-3.IR_full       121 TGGTGGACCTGTGCAATGGCGAGCAGTACTCCAATTGGTTCCTAAACCTCAATCCCAAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4623R-3.in silico     121 TGGTGGACCTGTGCAATGGCGAGCAGTACTCCAATTGGTTCCTAAACCTCAATCCCAAGG 180


4623R-3.IR_full       181 GCGATGTGCCAGTGCTCCAGGATGGCGCCCTCGTCATTCCCAGCTCGACGCACATCATCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4623R-3.in silico     181 GCGATGTGCCAGTGCTCCAGGATGGCGCCCTCGTCATTCCCAGCTCGACGCACATCATCA 240


4623R-3.IR_full       241 ACTATGTGGAGAGCAAATTTCGCGGTGATCGATCGCTGAANGCCAGCGCACAACTCCAAG 300
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
4623R-3.in silico     241 ACTATGTGGAGAGCAAATTTCGCGGTGATCGATCGCTGAA-GCCAGCGCACAACTCCAAG 300


4623R-3.IR_full       301 GAATTCGATCAGATGCTGGTCTTCGAGCAGGCAATGGCCCGCCTTCCGGTGGGAACACTC 360
                          ||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||
4623R-3.in silico     301 GAATTCGATCAAATGCTGATCTTCGAGCAGGCAATGGCCCGCCTTCCAGTGGGAACACTC 360


4623R-3.IR_full       361 AGCCTGGGCTCCTTCATACACGACGATCTGAAGCTGGTGCCCAAGGCGCCCTNTCATCGG 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
4623R-3.in silico     361 AGCCTGGGCTCCTTCATACACGACGATCTGAAGCTGGTGCCCAAGGCGCCCT-TCATCGG 420


4623R-3.IR_full       421 ACCCGTGCGCCAGTCCTGCCTGAAAAACAATGAAAAGGTGCTGGATCTGCTGCGCCACTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4623R-3.in silico     421 ACCCGTGCGCCAGTCCTGCCTGAAAAACAATGAAAAGGTGCTGGATCTGCTGCGCCACTC 480


4623R-3.IR_full       481 GGTGGACGAACAGGCGACCAAA 502
                          ||||||||||||||||||||||
4623R-3.in silico     481 GGTGGACGAACAGGCGACCAAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139688.2  CG4623-RA (CG4623), mRNA 
0.41   NM_144346.2  CG6264-RA (Best1), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_080337.2  CG6899-RA, transcript variant A (Ptp4E), mRNA 
0   NM_167024.1  CG6899-RB, transcript variant B (Ptp4E), mRNA 
0   NM_166100.1  CG30471-RA (CG30471), mRNA 
0   NM_141206.3  CG9855-RA (CG9855), mRNA 
0   NM_135083.2  CG6634-RA (mid), mRNA 
0   NM_164547.1  CG2808-RB, transcript variant B (CG2808), mRNA 
0   NM_134951.2  CG2808-RA, transcript variant A (CG2808), mRNA 
0   NM_165607.1  CG2127-RB, transcript variant B (CG2127), mRNA 
0   NM_136531.2  CG2127-RA, transcript variant A (CG2127), mRNA 
0   NM_001043044.1  CG17800-RM, transcript variant M (Dscam), mRNA 
0   NM_001043026.1  CG17800-RY, transcript variant Y (Dscam), mRNA 
0   NM_001043052.1  CG17800-RZ, transcript variant Z (Dscam), mRNA 
0   NM_001043059.1  CG17800-PAO (Dscam), mRNA 
0   NM_130478.2  CG2995-RA (CG2995), mRNA 
0   NM_143384.1  CG14529-RA (CG14529), mRNA 
0   NM_168385.1  CG6718-RD, transcript variant D (CG6718), mRNA 
0   NM_168384.1  CG6718-RC, transcript variant C (CG6718), mRNA 
0   NM_165914.1  CG30056-RA (CG30056), mRNA 
0   NM_132500.2  CG11699-RA (CG11699), mRNA 
0   NM_140109.1  CG6718-RA, transcript variant A (CG6718), mRNA 
0   NM_169758.1  CG5407-RA, transcript variant A (Sur-8), mRNA 
0   NM_142363.4  CG5407-RB, transcript variant B (Sur-8), mRNA 
0   NM_168383.1  CG6718-RB, transcript variant B (CG6718), mRNA 
0   NM_139805.1  CG10077-RA, transcript variant A (CG10077), mRNA 
0   NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.