National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4591R-1 
 Symbol Tsp86D  Full Name Tetraspanin 86D 
 CG No CG4591  Old CG No CG4591 
 Synonyms CG4591, Dm.Tsp86D, Tsp86D 
 Accession No (Link to NCBI) NM_079585.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dornier E, Coumailleau F, Ottavi JF, Moretti J, Boucheix C, Mauduit P, Schweisguth F, Rubinstein E.
TspanC8 tetraspanins regulate ADAM10/Kuzbanian trafficking and promote Notch activation in flies and mammals.
J. Cell Biol. (2012) 199(3) 481-96 [ PubMed ID = 23091066 ] [ RRC reference ]

Jeibmann A, Halama K, Witte HT, Kim SN, Eikmeier K, Koos B, Klämbt C, Paulus W.
Involvement of CD9 and PDGFR in migration is evolutionarily conserved from Drosophila glia to human glioma.
J. Neurooncol. (2015) 124(3) 373-83 [ PubMed ID = 26224160 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAATCACAGATACCATCAGGG 
 Primer Seq. 3'
aatctagaggtaccGCTGGGCAAAGTCGATGAAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAATCACAGA TACCATCAGG GGGGCAACTA CATGCACCCG CGGATCTCCa NCTATCCGCA 
0061 CCACTTCAGC TACGTTTCCT CTTGCGTCAA GTACATGATC TTCCTGCTAA ACTTCCTCTT 
0121 CTGGCTCTTC GGCGGCCTGC TCCTGGCCAT CGGCGTGNTA CGCCTTCATG GACAAACTGA 
0181 TGGACGGCAA TGGCTGGCTG CGCTTGGACA CCATCTACGA TGTGATCTTC AACATCTCCC 
0241 TGGTGATGAT CATCGCCGGA GTCATCGTCT TCACGGTCAg cTTCGCCGGC TGTTTGGgtN 
0301 NGCTNCGCGA GAACACCTGG CTGCTAAAGC TGTACTCCAT GTGCCTGCTT CTCTTCTTCA 
0361 TACTGGAGAT GTCGCTGGCC ATCATCTGCT TCGTTTTCCC GCAGTACATG AACTCGTTCC 
0421 TCGAGTACCA GTTCACGGAC AAAATCATCC ACTCGTACCG TGACGACTCC GACTTGCAAA 
0481 ACTTCATCGA CTTTGCCCAG C 
 in silico PCR Fragment
0001 CAATCACAGA TACCATCAGG GGGGCAACTA CATGCACCCG CGGATCTCCA CCTATCCGCA 
0061 CCACTTCAGC TACGTTTCCT CTTGCGTCAA GTACATGATC TTCCTGCTAA ACTTCCTCTT 
0121 CTGGCTCTTC GGCGGCCTGC TCCTGGCCAT CGGCGTG-TA CGCCTTCATG GACAAACTGA 
0181 TGGACGGCAA TGGCTGGCTG CGCTTGGACA CCATCTACGA TGTGATCTTC AACATCTCCC 
0241 TGGTGATGAT CATCGCCGGA GTCATCGTCT TCACGGTCAG CTTCGCCGGC TGTTTGGGTG 
0301 CGCTGCGCGA GAACACCTGG CTGCTAAAGC TGTACTCCAT GTGCCTGCTT CTCTTCTTCA 
0361 TACTGGAGAT GTCGCTGGCC ATCATCTGCT TCGTTTTCCC GCAGTACATG AACTCGTTCC 
0421 TCGAGTACCA GTTCACGGAC AAAATCATCC ACTCGTACCG TGACGACTCC GACTTGCAAA 
0481 ACTTCATCGA CTTTGCCCAG C 
 Assemble Data

4591R-1.IR_full       1   CAATCACAGATACCATCAGGGGGGCAACTACATGCACCCGCGGATCTCCANCTATCCGCA 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
4591R-1.in silico     1   CAATCACAGATACCATCAGGGGGGCAACTACATGCACCCGCGGATCTCCACCTATCCGCA 60


4591R-1.IR_full       61  CCACTTCAGCTACGTTTCCTCTTGCGTCAAGTACATGATCTTCCTGCTAAACTTCCTCTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4591R-1.in silico     61  CCACTTCAGCTACGTTTCCTCTTGCGTCAAGTACATGATCTTCCTGCTAAACTTCCTCTT 120


4591R-1.IR_full       121 CTGGCTCTTCGGCGGCCTGCTCCTGGCCATCGGCGTGNTACGCCTTCATGGACAAACTGA 180
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
4591R-1.in silico     121 CTGGCTCTTCGGCGGCCTGCTCCTGGCCATCGGCGTG-TACGCCTTCATGGACAAACTGA 180


4591R-1.IR_full       181 TGGACGGCAATGGCTGGCTGCGCTTGGACACCATCTACGATGTGATCTTCAACATCTCCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4591R-1.in silico     181 TGGACGGCAATGGCTGGCTGCGCTTGGACACCATCTACGATGTGATCTTCAACATCTCCC 240


4591R-1.IR_full       241 TGGTGATGATCATCGCCGGAGTCATCGTCTTCACGGTCAGCTTCGCCGGCTGTTTGGGTN 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
4591R-1.in silico     241 TGGTGATGATCATCGCCGGAGTCATCGTCTTCACGGTCAGCTTCGCCGGCTGTTTGGGTG 300


4591R-1.IR_full        301 GCTNCGCGAGAACACCTGGCTGCTAAAGCTGTACTCCATGTGCCTGCTTCTCTTCTTCA 359
                           ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
4591R-1.in silico      301 GCTGCGCGAGAACACCTGGCTGCTAAAGCTGTACTCCATGTGCCTGCTTCTCTTCTTCA 359


4591R-1.IR_full       361 TACTGGAGATGTCGCTGGCCATCATCTGCTTCGTTTTCCCGCAGTACATGAACTCGTTCC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4591R-1.in silico     361 TACTGGAGATGTCGCTGGCCATCATCTGCTTCGTTTTCCCGCAGTACATGAACTCGTTCC 419


4591R-1.IR_full       421 TCGAGTACCAGTTCACGGACAAAATCATCCACTCGTACCGTGACGACTCCGACTTGCAAA 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4591R-1.in silico     421 TCGAGTACCAGTTCACGGACAAAATCATCCACTCGTACCGTGACGACTCCGACTTGCAAA 479


4591R-1.IR_full       481 ACTTCATCGACTTTGCCCAGC 500
                          |||||||||||||||||||||
4591R-1.in silico     481 ACTTCATCGACTTTGCCCAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079585.2  CG4591-RA (Tsp86D), mRNA 
1.65   36  83  76  NM_080315.2  CG10742-RA (Tsp3A), mRNA 
0   61  176  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_132859.2  CG9066-RA (CG9066), mRNA 
0   NM_142275.1  CG17929-RA (CG17929), mRNA 
0   NM_057507.3  CG8442-RA (Glu-RI), mRNA 
0   NM_143054.2  CG11168-RA (CG11168), mRNA 
0   NM_142481.1  CG7698-RA (CG7698), mRNA 
0   NM_132000.2  CG12730-RA (CG12730), mRNA 
0   NM_079067.2  CG11949-RA, transcript variant A (cora), mRNA 
0   NM_078763.1  CG9093-RA (Tsp26A), mRNA 
0   NM_206455.1  CG33323-RA (Fer1), mRNA 
0   NM_176161.1  CG33007-RA (CG33007), mRNA 
0   NM_132104.2  CG3226-RA (CG3226), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_168041.1  CG32263-RA (CG32263), mRNA 
0   NM_167950.1  CG1146-RB, transcript variant B (CG1146), mRNA 
0   NM_167951.1  CG1146-RC, transcript variant C (CG1146), mRNA 
0   NM_139468.1  CG1146-RA, transcript variant A (CG1146), mRNA 
0   NM_176195.1  CG33017-RB (CG33017), mRNA 
0   NM_079278.2  CG3922-RB (RpS17), mRNA 
0   NM_136857.2  CG12443-RA (ths), mRNA 
0   NM_164933.1  CG7438-RB, transcript variant B (Myo31DF), mRNA 
0   NM_078814.2  CG7438-RA, transcript variant A (Myo31DF), mRNA 
0   NM_143510.1  CG15528-RA (CG15528), mRNA 
0   NM_166140.1  CG8421-RA, transcript variant A (Asph), mRNA 
0   NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0   NM_079033.2  CG8421-RB, transcript variant B (Asph), mRNA 
0   NM_165747.2  CG4001-RC, transcript variant C (Pfk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.