National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4590R-2 
 Symbol inx2  Full Name innexin 2 
 CG No CG4590  Old CG No CG4590 
 Synonyms inx-2, D-inx-2, kropf, Inx2, CG4590, Dm-inx2, Dm-inx, prp33, Ix2, l(1)G0036, l(1)G0035, l(1)G0043, l(1)G0317, l(1)G0118, l(1)G0059, l(1)G0157, l(1)G0364, inx2, INX-2 
 Accession No (Link to NCBI) NM_132147.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Smendziuk CM, Messenberg A, Vogl AW, Tanentzapf G.
Bi-directional gap junction-mediated soma-germline communication is essential for spermatogenesis.
Development (2015) 142(15) 2598-609 [ PubMed ID = 26116660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCTGGTGACCTCGCGCCAAT 
 Primer Seq. 3'
aatctagaggtaccGAACTCGCCGTCGAGGAAGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCTGGTGAC CTCGCGCCAA TACATCGGTG ACCCCATCGA TTGTATTGTG GACGAGATCC 
0061 CACTgGGCGT GATGGACACC TACTGCTGGA TCTACTCTAC GTTTACCGTG CCAGAGAGGC 
0121 TAACGGGCAT CACCGGACGC GATGTGGTGC AGCCCGGCGT GGGCTCCCAT GTGGAGGGCG 
0181 AGGACGAGGT GAAGTACCAC AAGTACTACC AGTGGGTGTG CTTCGTCCTC TTCTTCCAGG 
0241 CCATNCCTGT TCTACGTACC GCGCTATCTG TGGAAGTCCT GGGAAAGCGG ACGCCTCAAG 
0301 GATGCTGGTC ATGGATCTCA ACAGCCCTAT TGTGAACGAT GAGTGCAAGA ACGATCGCAA 
0361 AAAGATCCTG GTCGACTACT TCATTGGCAA CCTGAACCGC CACAATTTCT ACGCCTTCCG 
0421 ATTCTTCGTG TgCGAAGCCC TGAACTTTGT GAATGTGATT GGACAGATCT ACTTTGTGGA 
0481 CTTCTTCCTC GACGGCGAGT TC 
 in silico PCR Fragment
0001 TCCTGGTGAC CTCGCGCCAA TACATCGGTG ACCCCATCGA TTGTATTGTG GACGAGATCC 
0061 CACTGGGCGT GATGGACACC TACTGCTGGA TCTACTCTAC GTTTACCGTG CCAGAGAGGC 
0121 TAACGGGCAT CACCGGACGC GATGTGGTGC AGCCCGGCGT GGGCTCCCAT GTGGAGGGCG 
0181 AGGACGAGGT GAAGTACCAC AAGTACTACC AGTGGGTGTG CTTCGTCCTC TTCTTCCAGG 
0241 CCAT-CCTGT TCTACGTACC GCGCTATCTG TGGAAGTCCT GGGAAGGCGG ACGCCTCAA- 
0301 GATGCTGGTC ATGGATCTCA ACAGCCCTAT TGTGAACGAT GAGTGCAAGA ACGATCGCAA 
0361 AAAGATCCTG GTCGACTACT TCATTGGCAA CCTGAACCGC CACAATTTCT ACGCCTTCCG 
0421 ATTCTTCGTG TGCGAAGCCC TGAACTTTGT GAATGTGATT GGACAGATCT ACTTTGTGGA 
0481 CTTCTTCCTC GACGGCGAGT TC 
 Assemble Data

4590R-2.IR_full       1   TCCTGGTGACCTCGCGCCAATACATCGGTGACCCCATCGATTGTATTGTGGACGAGATCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4590R-2.in silico     1   TCCTGGTGACCTCGCGCCAATACATCGGTGACCCCATCGATTGTATTGTGGACGAGATCC 60


4590R-2.IR_full       61  CACTGGGCGTGATGGACACCTACTGCTGGATCTACTCTACGTTTACCGTGCCAGAGAGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4590R-2.in silico     61  CACTGGGCGTGATGGACACCTACTGCTGGATCTACTCTACGTTTACCGTGCCAGAGAGGC 120


4590R-2.IR_full       121 TAACGGGCATCACCGGACGCGATGTGGTGCAGCCCGGCGTGGGCTCCCATGTGGAGGGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4590R-2.in silico     121 TAACGGGCATCACCGGACGCGATGTGGTGCAGCCCGGCGTGGGCTCCCATGTGGAGGGCG 180


4590R-2.IR_full       181 AGGACGAGGTGAAGTACCACAAGTACTACCAGTGGGTGTGCTTCGTCCTCTTCTTCCAGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4590R-2.in silico     181 AGGACGAGGTGAAGTACCACAAGTACTACCAGTGGGTGTGCTTCGTCCTCTTCTTCCAGG 240


4590R-2.IR_full       241 CCATNCCTGTTCTACGTACCGCGCTATCTGTGGAAGTCCTGGGAAAGCGGACGCCTCAAG 300
                          |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| 
4590R-2.in silico     241 CCAT-CCTGTTCTACGTACCGCGCTATCTGTGGAAGTCCTGGGAAGGCGGACGCCTCAA- 300


4590R-2.IR_full       301 GATGCTGGTCATGGATCTCAACAGCCCTATTGTGAACGATGAGTGCAAGAACGATCGCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4590R-2.in silico     301 GATGCTGGTCATGGATCTCAACAGCCCTATTGTGAACGATGAGTGCAAGAACGATCGCAA 360


4590R-2.IR_full       361 AAAGATCCTGGTCGACTACTTCATTGGCAACCTGAACCGCCACAATTTCTACGCCTTCCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4590R-2.in silico     361 AAAGATCCTGGTCGACTACTTCATTGGCAACCTGAACCGCCACAATTTCTACGCCTTCCG 420


4590R-2.IR_full       421 ATTCTTCGTGTGCGAAGCCCTGAACTTTGTGAATGTGATTGGACAGATCTACTTTGTGGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4590R-2.in silico     421 ATTCTTCGTGTGCGAAGCCCTGAACTTTGTGAATGTGATTGGACAGATCTACTTTGTGGA 480


4590R-2.IR_full       481 CTTCTTCCTCGACGGCGAGTTC 502
                          ||||||||||||||||||||||
4590R-2.in silico     481 CTTCTTCCTCGACGGCGAGTTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132147.2  CG4590-RA, transcript variant A (inx2), mRNA 
100   482  NM_167104.1  CG4590-RB, transcript variant B (inx2), mRNA 
1.03   19  14  NM_167101.1  CG3039-RB, transcript variant B (ogre), mRNA 
1.03   19  14  NM_080085.2  CG3039-RA, transcript variant A (ogre), mRNA 
0.2   10  30  NM_170660.1  CG32508-RA, transcript variant A (shakB), mRNA 
0.2   10  25  NM_170661.1  CG32508-RB, transcript variant B (shakB), mRNA 
0   NM_080148.2  CG2522-RA (Gtp-bp), mRNA 
0   NM_140519.2  CG7739-RA (CG7739), mRNA 
0   NM_132490.2  CG1745-RB, transcript variant B (CG1745), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_080203.1  CG7620-RA (l(3)87Df), mRNA 
0   NM_142125.2  CG7825-RA (Rad17), mRNA 
0   NM_206786.1  CG32549-RB, transcript variant B (CG32549), mRNA 
0   NM_206787.1  CG32549-RA, transcript variant A (CG32549), mRNA 
0   NM_206785.1  CG32549-RF, transcript variant F (CG32549), mRNA 
0   NM_133061.2  CG32549-RD, transcript variant D (CG32549), mRNA 
0   NM_135426.2  CG9582-RA (CG9582), mRNA 
0   NM_079738.2  CG6768-RA (DNApol-epsilon), mRNA 
0   NM_134317.3  CG12021-RA, transcript variant A (Patj), mRNA 
0   NM_136779.2  CG6751-RA (CG6751), mRNA 
0   NM_057994.4  CG12021-RC, transcript variant C (Patj), mRNA 
0   NM_167917.2  CG12021-RB, transcript variant B (Patj), mRNA 
0   18  NM_176699.1  CG2977-RA, transcript variant A (inx7), mRNA 
0   13  NM_176698.1  CG2977-RB, transcript variant B (inx7), mRNA 
0   NM_164467.1  CG31682-RA (CG31682), mRNA 
0   NM_176272.1  CG33166-RB, transcript variant B (stet), mRNA 
0   NM_139971.1  CG6915-RA (CG6915), mRNA 
0   NM_001014741.1  CG11111-RC, transcript variant C (rdgB), mRNA 
0   NM_167382.1  CG11111-RA, transcript variant A (rdgB), mRNA 
0   NM_001014740.1  CG11111-RD, transcript variant D (rdgB), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.