National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4561R-2 
 Symbol Aats-tyr  Full Name Tyrosyl-tRNA synthetase 
 CG No CG4561  Old CG No CG4561 
 Synonyms CG4561, TyrRS, YRS, anon-EST:Posey261, Aats-tyr 
 Accession No (Link to NCBI) NM_140638.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Storkebaum E, Leitão-Gonçalves R, Godenschwege T, Nangle L, Mejia M, Bosmans I, Ooms T, Jacobs A, Van Dijck P, Yang XL, Schimmel P, Norga K, Timmerman V, Callaerts P, Jordanova A.
Dominant mutations in the tyrosyl-tRNA synthetase gene recapitulate in Drosophila features of human Charcot-Marie-Tooth neuropathy.
Proc. Natl. Acad. Sci. U.S.A. (2009) 106(28) 11782-7 [ PubMed ID = 19561293 ] [ RRC reference ]

Arsham AM, Neufeld TP.
A genetic screen in Drosophila reveals novel cytoprotective functions of the autophagy-lysosome pathway.
PLoS ONE (2009) 4(6) e6068 [ PubMed ID = 19562034 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGTCGGAATAACGCCCGCA 
 Primer Seq. 3'
aatctagaggtaccCCAGGATAAAGCAAACCGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGTCGGAA TAACGCCCGC AGAGAAGAAA GCGCTGATAA CGCgNAATCT GCAGGAGACG 
0061 CTCGGCGATG ACAAGCTGAC CAAGATCCTG GCGGAGCGcN ATCTAAAGAT CTACTGGGGA 
0121 ACGGCGACGA CGGGCAAGCC ACATGTCGCC TATTTCGTGC CCATGTCGAA GATTGCCGAT 
0181 TTCCTGAAGG CAGGATNCGA AGTGACCATC CTGTTCGCCG ATCTCCACGC CTATCTGGAC 
0241 AACATGAAGG CACCGTGGTC TCTCCTNGGA GCTGCGAACC AAGTACTACG AACAGGTCAT 
0301 CAAGGCCATG TTGANGCTCC ATNGGCGTTC CGCTGGAGAA ACTGAAGTTC GTCAAGGGCA 
0361 GCGACTATCA GCTGTCCAAG GAGTACACCC TGGATGTATA CAAGCTCAGC TCCGTGGTCA 
0421 CGCAACACGA TGCCAAGAAg GCGGGCGCAG AGGTGGTCAA ACAGGTGGAG TACCCACTGC 
0481 TCTCCGGTTT GCTTTATCCT GG 
 in silico PCR Fragment
0001 ATGGTCGGAA TAACGCCCGC AGAGAAGAAA GCGCTGATAA CGCGCAATCT GCAGGAGACG 
0061 CTCGGCGATG ACAAGCTGAC CAAGATCCTG GCGGAGCGCG ATCTAAAGAT CTACTGGGGA 
0121 ACGGCGACGA CGGGCAAGCC ACATGTCGCC TATTTCGTGC CCATGTCGAA GATTGCCGAT 
0181 TTCCTGAAGG CAGGATGCGA AGTGACCATC CTGTTCGCCG ATCTCCACGC CTATCTGGAC 
0241 AACATGAAGG CACCGTGGTC TCTCCT-GGA GCTGCGAACC AAGTACTACG AACAGGTCAT 
0301 CAAGGCCATG TTGA-GCTCC ATCGGCGTTC CGCTGGAGAA ACTGAAGTTC GTCAAGGGCA 
0361 GCGACTATCA GCTGTCCAAG GAGTACACCC TGGATGTATA CAAGCTCAGC TCCGTGGTCA 
0421 CGCAACACGA TGCCAAGAAG GCGGGCGCAG AGGTGGTCAA ACAGGTGGAG TACCCACTGC 
0481 TCTCCGGTTT GCTTTATCCT GG 
 Assemble Data

4561R-2.IR_full       1   ATGGTCGGAATAACGCCCGCAGAGAAGAAAGCGCTGATAACGCGNAATCTGCAGGAGACG 60
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
4561R-2.in silico     1   ATGGTCGGAATAACGCCCGCAGAGAAGAAAGCGCTGATAACGCGCAATCTGCAGGAGACG 60


4561R-2.IR_full       61  CTCGGCGATGACAAGCTGACCAAGATCCTGGCGGAGCGCNATCTAAAGATCTACTGGGGA 120
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
4561R-2.in silico     61  CTCGGCGATGACAAGCTGACCAAGATCCTGGCGGAGCGCGATCTAAAGATCTACTGGGGA 120


4561R-2.IR_full       121 ACGGCGACGACGGGCAAGCCACATGTCGCCTATTTCGTGCCCATGTCGAAGATTGCCGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4561R-2.in silico     121 ACGGCGACGACGGGCAAGCCACATGTCGCCTATTTCGTGCCCATGTCGAAGATTGCCGAT 180


4561R-2.IR_full       181 TTCCTGAAGGCAGGATNCGAAGTGACCATCCTGTTCGCCGATCTCCACGCCTATCTGGAC 240
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
4561R-2.in silico     181 TTCCTGAAGGCAGGATGCGAAGTGACCATCCTGTTCGCCGATCTCCACGCCTATCTGGAC 240


4561R-2.IR_full       241 AACATGAAGGCACCGTGGTCTCTCCTNGGAGCTGCGAACCAAGTACTACGAACAGGTCAT 300
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
4561R-2.in silico     241 AACATGAAGGCACCGTGGTCTCTCCT-GGAGCTGCGAACCAAGTACTACGAACAGGTCAT 300


4561R-2.IR_full       301 CAAGGCCATGTTGANGCTCCATNGGCGTTCCGCTGGAGAAACTGAAGTTCGTCAAGGGCA 360
                          |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||
4561R-2.in silico     301 CAAGGCCATGTTGA-GCTCCATCGGCGTTCCGCTGGAGAAACTGAAGTTCGTCAAGGGCA 360


4561R-2.IR_full       361 GCGACTATCAGCTGTCCAAGGAGTACACCCTGGATGTATACAAGCTCAGCTCCGTGGTCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4561R-2.in silico     361 GCGACTATCAGCTGTCCAAGGAGTACACCCTGGATGTATACAAGCTCAGCTCCGTGGTCA 420


4561R-2.IR_full       421 CGCAACACGATGCCAAGAAGGCGGGCGCAGAGGTGGTCAAACAGGTGGAGTACCCACTGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4561R-2.in silico     421 CGCAACACGATGCCAAGAAGGCGGGCGCAGAGGTGGTCAAACAGGTGGAGTACCCACTGC 480


4561R-2.IR_full       481 TCTCCGGTTTGCTTTATCCTGG 502
                          ||||||||||||||||||||||
4561R-2.in silico     481 TCTCCGGTTTGCTTTATCCTGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140638.2  CG4561-RA (Aats-tyr), mRNA 
0.2   NM_136976.1  CG17577-RA (Cyp9h1), mRNA 
0   NM_168056.1  CG14994-RC, transcript variant C (Gad1), mRNA 
0   NM_079190.2  CG14994-RA, transcript variant A (Gad1), mRNA 
0   NM_168055.1  CG14994-RB, transcript variant B (Gad1), mRNA 
0   NM_079554.2  CG7954-RA, transcript variant A (stck), mRNA 
0   NM_169220.1  CG7954-RB, transcript variant B (stck), mRNA 
0   NM_169221.1  CG7954-RC, transcript variant C (stck), mRNA 
0   NM_134993.1  CG15440-RA (CG15440), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 
0   NM_136983.2  CG17019-RA (CG17019), mRNA 
0   NM_137205.2  CG8195-RA (CG8195), mRNA 
0   NM_170304.1  CG31075-RA (CG31075), mRNA 
0   NM_140358.1  CG10748-RA (CG10748), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_079643.1  CG5178-RA (Act88F), mRNA 
0   NM_138010.3  CG16783-RA (fzr2), mRNA 
0   NM_134967.2  CG3980-RB, transcript variant B (CG3980), mRNA 
0   NM_164563.2  CG3980-RA, transcript variant A (CG3980), mRNA 
0   NM_134531.2  CG9577-RA (CG9577), mRNA 
0   NM_079679.2  CG5557-RA (sqz), mRNA 
0   NM_078815.2  CG6098-RA (Lrr47), mRNA 
0   NM_165737.1  CG2269-RB, transcript variant B (CG2269), mRNA 
0   NM_165738.1  CG2269-RC, transcript variant C (CG2269), mRNA 
0   NM_136709.2  CG2269-RA, transcript variant A (CG2269), mRNA 
0   NM_136192.2  CG2508-RA (cdc23), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_137707.2  CG30388-RA (Magi), mRNA 
0   NM_001032233.1  CG13203-RB, transcript variant B (CG13203), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.