National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4496R-3 
 Symbol CG4496  Full Name CG4496 
 CG No CG4496  Old CG No CG4496 
 Synonyms CG4496 
 Accession No (Link to NCBI) NM_135257.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tang HW, Spirohn K, Hu Y, Hao T, Kovács IA, Gao Y, Binari R, Yang-Zhou D, Wan KH, Bader JS, Balcha D, Bian W, Booth BW, Coté AG, de Rouck S, Desbuleux A, Goh KY, Kim DK, Knapp JJ, Lee WX, Lemmens I, Li C, Li M, Li R, Lim HJ, Liu Y, Luck K, Markey D, Pollis C, Rangarajan S, Rodiger J, Schlabach S, Shen Y, Sheykhkarimli D, TeeKing B, Roth FP, Tavernier J, Calderwood MA, Hill DE, Celniker SE, Vidal M, Perrimon N, Mohr SE.
Next-generation large-scale binary protein interaction network for Drosophila melanogaster.
Nat Commun (2023) 14(1) 2162 [ PubMed ID = 37061542 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCGCCCGATCCAGTCAGATA 
 Primer Seq. 3'
aatctagaggtaccAGGGCACGATGATCACCAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCGCCCGAT CCAGTCAGAT ATGAGTACCA GGAGCCCGAG GAGAACTTCA TATCCATTGA 
0061 TGATGTGAAA ATCAAGAGTT TCCTGTGGCA AATCGGCCAG CAGCAGAGGG AAAAGGAGTT 
0121 GGAAATCAAA AGGATCATGG AACAAGAGAA AAGGGAGAAA AGAGAGAAGG AAAGGCGGGA 
0181 GGCCGAAAAG CGAAGAGATC AAGAGGTAAT CGAATTGGAC GAGGAGGAGG CTCAATCTCC 
0241 TCGGGGTCTC ATAATCAGCG CAGCCAGGAG TCTAGCCCAT TGGAATTCAT CCATTAGGAG 
0301 GGTAACACCA GATATCGAAC TGATTCCCAG ACGGGTGCAC AGGGTTGTCG CAGAAATCGA 
0361 ACTGAGTGAT AGTGATCACG ATGAAGATAG TGAAGTAGAT GAGGATGTAA GTCTTCCATC 
0421 AAACGCTGTA AGCTGCGTCC TGAATGAGCA GAGACAGGAT GGAAGCCAGA ACCAGAATCC 
0481 ACAGGAACTG GTGATCATCG TGCCCT 
 in silico PCR Fragment
0001 ACCGCCCGAT CCAGTCAGAT ATGAGTACCA GGAGCCCGAG GAGAACTTCA TATCCATTGA 
0061 TGATGTGAAA ATCAAGAGTT TCCTGTGGCA AATCGGCCAG CAGCAGAGGG AAAAGGAGTT 
0121 GGAAATCAAA AGGATCATGG AACAAGAGAA AAGGGAGAAA AGAGAGAAGG AAAGGCGGGA 
0181 GGCCGAAAAG CGAAGAGATC AAGAGGTAAT CGAATTGGAC GAGGAGGAGG CTCAATCTCC 
0241 TCGGGGTCTC ATAATCAGCG CAGCCAGGAG TCTAGCCCAT TGGAATTCAT CCATTAGGAG 
0301 GGTAACACCA GATATCGAAC TGATTCCCAG ACGGGTGCAC AGGGTTGTCG CAGAAATCGA 
0361 ACTGAGTGAT AGTGATCACG ATGAAGATAG TGAAGTAGAT GAGGATGTAA GTCTTCCATC 
0421 AAACGCTGTA AGCTGCGTCC TGAATGAGCA GAGACAGGAT GGAAG----- -CCAGAATCC 
0481 ACAGGAACTG GTGATCATCG TGCCCT 
 Assemble Data

4496R-3.IR_full       1   ACCGCCCGATCCAGTCAGATATGAGTACCAGGAGCCCGAGGAGAACTTCATATCCATTGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4496R-3.in silico     1   ACCGCCCGATCCAGTCAGATATGAGTACCAGGAGCCCGAGGAGAACTTCATATCCATTGA 60


4496R-3.IR_full       61  TGATGTGAAAATCAAGAGTTTCCTGTGGCAAATCGGCCAGCAGCAGAGGGAAAAGGAGTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4496R-3.in silico     61  TGATGTGAAAATCAAGAGTTTCCTGTGGCAAATCGGCCAGCAGCAGAGGGAAAAGGAGTT 120


4496R-3.IR_full       121 GGAAATCAAAAGGATCATGGAACAAGAGAAAAGGGAGAAAAGAGAGAAGGAAAGGCGGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4496R-3.in silico     121 GGAAATCAAAAGGATCATGGAACAAGAGAAAAGGGAGAAAAGAGAGAAGGAAAGGCGGGA 180


4496R-3.IR_full       181 GGCCGAAAAGCGAAGAGATCAAGAGGTAATCGAATTGGACGAGGAGGAGGCTCAATCTCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4496R-3.in silico     181 GGCCGAAAAGCGAAGAGATCAAGAGGTAATCGAATTGGACGAGGAGGAGGCTCAATCTCC 240


4496R-3.IR_full       241 TCGGGGTCTCATAATCAGCGCAGCCAGGAGTCTAGCCCATTGGAATTCATCCATTAGGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4496R-3.in silico     241 TCGGGGTCTCATAATCAGCGCAGCCAGGAGTCTAGCCCATTGGAATTCATCCATTAGGAG 300


4496R-3.IR_full       301 GGTAACACCAGATATCGAACTGATTCCCAGACGGGTGCACAGGGTTGTCGCAGAAATCGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4496R-3.in silico     301 GGTAACACCAGATATCGAACTGATTCCCAGACGGGTGCACAGGGTTGTCGCAGAAATCGA 360


4496R-3.IR_full       361 ACTGAGTGATAGTGATCACGATGAAGATAGTGAAGTAGATGAGGATGTAAGTCTTCCATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4496R-3.in silico     361 ACTGAGTGATAGTGATCACGATGAAGATAGTGAAGTAGATGAGGATGTAAGTCTTCCATC 420


4496R-3.IR_full       421 AAACGCTGTAAGCTGCGTCCTGAATGAGCAGAGACAGGATGGAAGCCAGAACCAGAATCC 480
                          |||||||||||||||||||||||||||||||||||||||||||||      |||||||||
4496R-3.in silico     421 AAACGCTGTAAGCTGCGTCCTGAATGAGCAGAGACAGGATGGAAG------CCAGAATCC 480


4496R-3.IR_full       481 ACAGGAACTGGTGATCATCGTGCCCT 506
                          ||||||||||||||||||||||||||
4496R-3.in silico     481 ACAGGAACTGGTGATCATCGTGCCCT 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135257.1  CG4496-RA (CG4496), mRNA 
0   NM_144367.1  CG6633-RA (Ugt86Dd), mRNA 
0   NM_136926.1  CG13155-RA (CG13155), mRNA 
0   NM_136005.1  CG15144-RA (CG15144), mRNA 
0   NM_057242.3  CG7765-RA (Khc), mRNA 
0   NM_139503.1  CG2162-RA (CG2162), mRNA 
0   NM_139954.1  CG7083-RA (CG7083), mRNA 
0   NM_206720.1  CG8948-RD, transcript variant D (Graf), mRNA 
0   NM_139405.1  CG12020-RA (CG12020), mRNA 
0   NM_206719.1  CG8948-RE, transcript variant E (Graf), mRNA 
0   NM_140840.2  CG9648-RA (Max), mRNA 
0   NM_143031.1  CG11375-RA (polybromo), mRNA 
0   NM_137994.2  CG5554-RA (CG5554), mRNA 
0   NM_142836.2  CG6990-RA (HP1c), mRNA 
0   NM_206507.1  CG7156-RB, transcript variant B (CG7156), mRNA 
0   NM_142440.2  CG7156-RA, transcript variant A (CG7156), mRNA 
0   NM_139582.1  CG12766-RA (CG12766), mRNA 
0   NM_143178.1  CG5886-RA (CG5886), mRNA 
0   NM_167842.1  CG13900-RA, transcript variant A (CG13900), mRNA 
0   NM_143333.1  CG5566-RA (CG5566), mRNA 
0   NM_142176.2  CG31344-RA (CG31344), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_132019.1  CG4096-RA (CG4096), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_170523.2  CG1322-RA, transcript variant A (zfh1), mRNA 
0   NM_137734.2  CG30394-RB, transcript variant B (CG30394), mRNA 
0   NM_137735.1  CG30394-RA, transcript variant A (CG30394), mRNA 
0   NM_058003.3  CG5216-RA (Sir2), mRNA 
0   NM_058030.3  CG4581-RA (Thiolase), mRNA 
0   NM_169563.1  CG3041-RA (Orc2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.