National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4445R-4 
 Symbol pgant3  Full Name polypeptide GalNAc transferase 3 
 CG No CG4445  Old CG No CG4445 
 Synonyms CG4445, BcDNA:GH09147, anon-WO0118547.119, pgant3 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGTCTCCGGTTCCAGCAG 
 Primer Seq. 3'
aatctagaggtaccATGGTTCGCAGGAGCACGGAC 
 Predicted Fragment Size
509 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

4445R-4.IR full       1   ATGGGTCTCCGGTTCCAGCAGCTGAAGAAGCTCTGGCTGCTCTACCTTTTCCTGCTCTTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4445R-4.in silico     1   ATGGGTCTCCGGTTCCAGCAGCTGAAGAAGCTCTGGCTGCTCTACCTTTTCCTGCTCTTC 60


4445R-4.IR full       61  TTCGCGTTCTTCATGTTCGCCATCAGCATCAACCTGTACGTGGCCAGCATCCAGGGCGGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4445R-4.in silico     61  TTCGCGTTCTTCATGTTCGCCATCAGCATCAACCTGTACGTGGCCAGCATCCAGGGCGGG 120


4445R-4.IR full       121 GACGCGGAGATGCGTCATCCGAAACCGCCGCCCAAGCGCCGCTCCCTCTGGCCGCACAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4445R-4.in silico     121 GACGCGGAGATGCGTCATCCGAAACCGCCGCCCAAGCGCCGCTCCCTCTGGCCGCACAAA 180


4445R-4.IR full       181 AACATCGTGGCCCACTACATCGGCAAGGGAGACATCTTTGGCAACATGACAGCAGATGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4445R-4.in silico     181 AACATCGTGGCCCACTACATCGGCAAGGGAGACATCTTTGGCAACATGACAGCAGATGAT 240


4445R-4.IR full       241 TACAACATCAACCTGTTCCAGCCCATCAACGGAGAAGGTGCCGATGGGCGACCAGTTGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4445R-4.in silico     241 TACAACATCAACCTGTTCCAGCCCATCAACGGAGAAGGTGCCGATGGGCGACCAGTTGTG 300


4445R-4.IR full       301 GTGCCGCCTCGCGATCGCTTTCGCATGCAGCGCTTTTTCCGGCTAAACAGCTTCAACCTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4445R-4.in silico     301 GTGCCGCCTCGCGATCGCTTTCGCATGCAGCGCTTTTTCCGGCTAAACAGCTTCAACCTG 360


4445R-4.IR full       361 CTGGCCAGCGACCGCATCCCACTGAACCGCACCCTCAAGGACTACCGCACACCTGAATGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4445R-4.in silico     361 CTGGCCAGCGACCGCATCCCACTGAACCGCACCCTCAAGGACTACCGCACACCTGAATGC 420


4445R-4.IR full       421 CGCGACAAGAAGTACGCCAGCGGTCTACCCAGCACGTCGGTTATAATTGTTTTCCACAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4445R-4.in silico     421 CGCGACAAGAAGTACGCCAGCGGTCTACCCAGCACGTCGGTTATAATTGTTTTCCACAAC 480


4445R-4.IR full       481 GAGGCCTGGTCCGTGCTCCTGCGAACCAT 509
                          |||||||||||||||||||||||||||||
4445R-4.in silico     481 GAGGCCTGGTCCGTGCTCCTGCGAACCAT 509

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  491  NM_136412.2  polypeptide GalNAc transferase 3 CG4445-RA (pgant3), mRNA 
0.4  NM_078907.2  Tetraspanin 42Ee CG10106-RA (Tsp42Ee), mRNA 
NM_137013.2  CG4714-RA (CG4714), mRNA 
NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
NM_132425.3  CG15211-RA (CG15211), mRNA 
NM_138095.1  CG13587-RA (CG13587), mRNA 
NM_140132.3  CG32056-RA, transcript variant A (CG32056), mRNA 
NM_139732.2  CG10542-RA (CG10542), mRNA 
NM_137085.2  CG13016-RA (CG13016), mRNA 
NM_080110.2  Ecdysone-inducible gene E1 CG32356-RA, transcript variant A (ImpE1), mRNA 
NM_170547.2  gasket CG31003-RA (gskt), mRNA 
NM_167623.1  UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
NM_133073.2  UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
NM_141338.1  CG2023-RA (CG2023), mRNA 
NM_080337.2  Protein tyrosine phosphatase 4E CG6899-RA, transcript variant A (Ptp4E), mRNA 
NM_166083.1  scab CG8095-RA, transcript variant A (scb), mRNA 
NM_079026.2  scab CG8095-RB, transcript variant B (scb), mRNA 
14  NM_001032051.1  Muscle-specific protein 300 CG33715-RD, transcript variant D (Msp-300), mRNA 
NM_137133.2  Adenosine deaminase-related growth factor E CG10143-RA (Adgf-E), mRNA 
NM_137033.2  CG6016-RA, transcript variant A (CG6016), mRNA 
NM_165993.1  CG6016-RB, transcript variant B (CG6016), mRNA 
NM_132543.1  CG10362-RA (CG10362), mRNA 
NM_169191.2  CG31146-RD (CG31146), mRNA 
NM_167024.1  Protein tyrosine phosphatase 4E CG6899-RB, transcript variant B (Ptp4E), mRNA 
NM_079503.2  Neprilysin 2 CG9761-RA (Nep2), mRNA 
NM_136692.1  CG12140-RA (CG12140), mRNA 
NM_080325.3  lava lamp CG6450-RC (lva), mRNA 
NM_134538.1  CG1504-RA (CG1504), mRNA 
NM_169584.1  CG31330-RA (CG31330), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.