National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4432R-1 
 Symbol PGRP-LC  Full Name Peptidoglycan recognition protein LC 
 CG No CG4432  Old CG No CG4432 
 Synonyms CG4432, ird7, PGRP-LCx, PGRP-LCa, tot, PGRP-LC, (PGRP)-LC 
 Accession No (Link to NCBI) NM_168324.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Zaidman-Rémy A, Hervé M, Poidevin M, Pili-Floury S, Kim MS, Blanot D, Oh BH, Ueda R, Mengin-Lecreulx D, Lemaitre B.
The Drosophila amidase PGRP-LB modulates the immune response to bacterial infection.
Immunity (2006) 24(4) 463-73 [ PubMed ID = 16618604 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTTCGCCGGCGGTTTCCATA 
 Primer Seq. 3'
aatctagaggtaccCCACCATTGAATGCGGGGTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTTCGCCGG CGGTTTCCAT ACGGAGtACC ACAATTTCCG TTGTGTCCAT CGATGATAAT 
0061 GCCATCGACT CGAGTAGTAT TGATAGTGAT TCGGAGGCCG AAGCGGAGGA TTATACGGTC 
0121 CAGAAGCTGG GTCACCAGGT CACCTACCCG CCCAACAGTT CACACCTGCG CGACCTTAAC 
0181 CAGGGTCTAA CGGTGATCAG TCGTCATGTG GCGCCAGGTG AGGCGGCAGT ACCACCACCC 
0241 AATCCCCTGG AAGCTGGCAT TGTGGcCAAG CAAATACTGA ACGGTAATCT GGCCGTGgCC 
0301 ACGCCCACAT CGCCGGcGGG CGGTGCCACG CAGGGTATTG GCAGCATCGC CCTGACCAAC 
0361 TCCACAGATG TGACGTTCGG TGATAAGCAN TTCTACGAGG GACCCGTGAC GATACAACAG 
0421 TTTCTCATCG ATAATCGGGA CAAGTGGAAA CCGGGCGAGG GACCAGCTGG TGGACAGGAT 
0481 AACCCCGCAT TCAATGGTGG  
 in silico PCR Fragment
0001 TCTTCGCCGG CGGTTTCCAT ACGGAGTACC ACAATTTCCG TTGTGTCCAT CGATGATAAT 
0061 GCCATCGACT CGAGTAGTAT TGATAGTGAT TCGGAGGCCG AAGCGGAGGA TTATACGGTC 
0121 CAGAAGCTGG GTCACCAGGT CACCTACCCG CCCAACAGTT CACACCTGCG CGACCTTAAC 
0181 CAGGGTCTAA CGGTGATCAG TCGCCATGTG GCGCCAGGTG AGGCGGCAGT ACCACCACCC 
0241 AATCCCCTGG AAGCTGGCAT TGTGGCCAAG CAAATACTGA ACGGTAATCT GGCCGTGGCC 
0301 ACGCCCACAT CGCCGGCGGG CGGTGCCACG CAGGGTATTG GCAGCATCGC CCTGACCAAC 
0361 TCCACAGATG TGACGTTCGG TGATAAGCAT TTCTACGAGG GACCCGTGAC GATACAACAG 
0421 TTTCTCATCG ATAATCGGGA CAAGTGGAAA CCGGGCGAGG GACCAGCTGG TGGACAGGAT 
0481 AACCCCGCAT TCAATGGTGG  
 Assemble Data

4432R-1.IR_full       1   TCTTCGCCGGCGGTTTCCATACGGAGTACCACAATTTCCGTTGTGTCCATCGATGATAAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4432R-1.in silico     1   TCTTCGCCGGCGGTTTCCATACGGAGTACCACAATTTCCGTTGTGTCCATCGATGATAAT 60


4432R-1.IR_full       61  GCCATCGACTCGAGTAGTATTGATAGTGATTCGGAGGCCGAAGCGGAGGATTATACGGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4432R-1.in silico     61  GCCATCGACTCGAGTAGTATTGATAGTGATTCGGAGGCCGAAGCGGAGGATTATACGGTC 120


4432R-1.IR_full       121 CAGAAGCTGGGTCACCAGGTCACCTACCCGCCCAACAGTTCACACCTGCGCGACCTTAAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4432R-1.in silico     121 CAGAAGCTGGGTCACCAGGTCACCTACCCGCCCAACAGTTCACACCTGCGCGACCTTAAC 180


4432R-1.IR_full       181 CAGGGTCTAACGGTGATCAGTCGTCATGTGGCGCCAGGTGAGGCGGCAGTACCACCACCC 240
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
4432R-1.in silico     181 CAGGGTCTAACGGTGATCAGTCGCCATGTGGCGCCAGGTGAGGCGGCAGTACCACCACCC 240


4432R-1.IR_full       241 AATCCCCTGGAAGCTGGCATTGTGGCCAAGCAAATACTGAACGGTAATCTGGCCGTGGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4432R-1.in silico     241 AATCCCCTGGAAGCTGGCATTGTGGCCAAGCAAATACTGAACGGTAATCTGGCCGTGGCC 300


4432R-1.IR_full       301 ACGCCCACATCGCCGGCGGGCGGTGCCACGCAGGGTATTGGCAGCATCGCCCTGACCAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4432R-1.in silico     301 ACGCCCACATCGCCGGCGGGCGGTGCCACGCAGGGTATTGGCAGCATCGCCCTGACCAAC 360


4432R-1.IR_full       361 TCCACAGATGTGACGTTCGGTGATAAGCANTTCTACGAGGGACCCGTGACGATACAACAG 420
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
4432R-1.in silico     361 TCCACAGATGTGACGTTCGGTGATAAGCATTTCTACGAGGGACCCGTGACGATACAACAG 420


4432R-1.IR_full       421 TTTCTCATCGATAATCGGGACAAGTGGAAACCGGGCGAGGGACCAGCTGGTGGACAGGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4432R-1.in silico     421 TTTCTCATCGATAATCGGGACAAGTGGAAACCGGGCGAGGGACCAGCTGGTGGACAGGAT 480


4432R-1.IR_full       481 AACCCCGCATTCAATGGTGG 500
                          ||||||||||||||||||||
4432R-1.in silico     481 AACCCCGCATTCAATGGTGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140041.2  CG4432-RB, transcript variant B (PGRP-LC), mRNA 
100   482  NM_206308.2  CG4432-RC, transcript variant C (PGRP-LC), mRNA 
100   482  NM_168324.2  CG4432-RA, transcript variant A (PGRP-LC), mRNA 
0.41   NM_080421.3  CG18730-RA (Amy-p), mRNA 
0.41   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0.2   NM_141657.2  CG8273-RA (CG8273), mRNA 
0   NM_143306.2  CG13977-RA (Cyp6a18), mRNA 
0   NM_141165.1  CG13239-RA (CG13239), mRNA 
0   NM_135169.2  CG9493-RA (Pez), mRNA 
0   NM_079025.3  CG10248-RA (Cyp6a8), mRNA 
0   NM_144472.2  CG1898-RA (HBS1), mRNA 
0   NM_166535.1  CG4444-RA (px), mRNA 
0   NM_139595.2  CG1135-RA (CG1135), mRNA 
0   NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 
0   NM_132619.1  CG2209-RA (CG2209), mRNA 
0   NM_143465.1  CG1973-RA (CG1973), mRNA 
0   NM_057676.3  CG11312-RA (insc), mRNA 
0   10  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   10  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   10  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_140200.1  CG6175-RB (CG6175), mRNA 
0   NM_140393.2  CG10732-RB, transcript variant B (CG10732), mRNA 
0   NM_168546.1  CG10732-RA, transcript variant A (CG10732), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   NM_142521.1  CG6026-RA (CG6026), mRNA 
0   21  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_142201.1  CG14868-RA (CG14868), mRNA 
0   NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
0   NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.