National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4427R-2 
 Symbol cbt  Full Name cabut 
 CG No CG4427  Old CG No CG4427 
 Synonyms CG4427, EP2237, EP(2)2237, dTIEG, cbt 
 Accession No (Link to NCBI) NM_164384.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Belacortu Y, Weiss R, Kadener S, Paricio N.
Expression of Drosophila Cabut during early embryogenesis, dorsal closure and nervous system development.
Gene Expr. Patterns (2011) 11(3-4) 190-201 [ PubMed ID = 21109026 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATACCTTGCTACCTTCACCAC 
 Primer Seq. 3'
aatctagaggtaccTTCTGCAGCACGCTTTCTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATACCTTGCT ACCTTCACCA CCCGCAACgN CCCCACTAAG GGAAAACAAG TTGGAAATCG 
0061 TCGCCAAGGA CGAACAACAG GTGAACGAGA ATCTGCTAAA GGCAAAGCTC AANGCTGGTG 
0121 GCCCAAAAGA GTCAGAAAAA ATGGAGGGAT TATTACACCA AATCCATCGG ACACGGGAAG 
0181 ACGAGGCTCC CCGAAATNAG CGGTTCCCAA CAAGAAACCC CGTTTGGAAC AACTTGCTAT 
0241 GAGCATGACA CCGCCGCCCG GATCAAAAGC TGGACGATGA TCAGAAAGCG GAAAGGGTTA 
0301 GCGTCATCAT GCGGGTCAAC AGTTCTGGCG CTGTCTCTTC TAGTAGCCAA GACGAGAACT 
0361 CATCTAGTTC CACCTCCTGC TGTAGTTCCT CTTCCAACAC AAACACAAGT ACAAGTTCAG 
0421 TACCACCCAC TGTGGAGGAC GACTATCCAG AGGCCAATGT GTGGCGCAAT CTCAAGTTCA 
0481 AAATGAACAG AAAGCGTGCT GCAGAA 
 in silico PCR Fragment
0001 ATACCTTGCT ACCTTCACCA CCCGCAACGC CCCCACTAAG GGAAAACAAG TTGGAAATCG 
0061 TCGCCAAGGA CGAACAACAG GTGAACGAGA ATCTGCTAAA GGCAAAGCTC AA-GCTGGTG 
0121 GCCCAAAAGA GTCAG-AAAA ATGGAGGGAT TATTACACCA AATCCATCGG ACAC-GGAAG 
0181 ACGAGGCT-C CCGAAAT-AG CGGTTCCCAA CAAGAAACCC CGTTTGGAAC AACCTGCTAT 
0241 GAGCATGACA CCGCCG-CCG GATCAAAAGC TGGACGATGA TCAGAAAGCG GAAAGGGTTA 
0301 GCGTCATCAT GCGGGTCAAC AGTTCTGGCG CTGTCTCTTC TAGTAGCCAA GACGAGAACT 
0361 CATCTAGTTC CACCTCCTGC TGTAGTTCCT CTTCCAACAC AAACACAAGT ACAAGTTCAG 
0421 TACCACCCAC TGTGGAGGAC GACTATCCAG AGGCCAATGT GTGGCGCAAT CTCAAGTTCA 
0481 AAATGAACAG AAAGCGTGCT GCAGAA 
 Assemble Data

4427R-2.IR_full       1   ATACCTTGCTACCTTCACCACCCGCAACGNCCCCACTAAGGGAAAACAAGTTGGAAATCG 60
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
4427R-2.in silico     1   ATACCTTGCTACCTTCACCACCCGCAACGCCCCCACTAAGGGAAAACAAGTTGGAAATCG 60


4427R-2.IR_full       61  TCGCCAAGGACGAACAACAGGTGAACGAGAATCTGCTAAAGGCAAAGCTCAANGCTGGTG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
4427R-2.in silico     61  TCGCCAAGGACGAACAACAGGTGAACGAGAATCTGCTAAAGGCAAAGCTCAA-GCTGGTG 120


4427R-2.IR_full       121 GCCCAAAAGAGTCAGAAAAAATGGAGGGATTATTACACCAAATCCATCGGACACGGGAAG 180
                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
4427R-2.in silico     121 GCCCAAAAGAGTCAG-AAAAATGGAGGGATTATTACACCAAATCCATCGGACAC-GGAAG 180


4427R-2.IR_full       181 ACGAGGCTCCCCGAAATNAGCGGTTCCCAACAAGAAACCCCGTTTGGAACAACTTGCTAT 240
                          |||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||
4427R-2.in silico     181 ACGAGGCT-CCCGAAAT-AGCGGTTCCCAACAAGAAACCCCGTTTGGAACAACCTGCTAT 240


4427R-2.IR_full       241 GAGCATGACACCGCCGCCCGGATCAAAAGCTGGACGATGATCAGAAAGCGGAAAGGGTTA 300
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
4427R-2.in silico     241 GAGCATGACACCGCCG-CCGGATCAAAAGCTGGACGATGATCAGAAAGCGGAAAGGGTTA 300


4427R-2.IR_full       301 GCGTCATCATGCGGGTCAACAGTTCTGGCGCTGTCTCTTCTAGTAGCCAAGACGAGAACT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4427R-2.in silico     301 GCGTCATCATGCGGGTCAACAGTTCTGGCGCTGTCTCTTCTAGTAGCCAAGACGAGAACT 360


4427R-2.IR_full       361 CATCTAGTTCCACCTCCTGCTGTAGTTCCTCTTCCAACACAAACACAAGTACAAGTTCAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4427R-2.in silico     361 CATCTAGTTCCACCTCCTGCTGTAGTTCCTCTTCCAACACAAACACAAGTACAAGTTCAG 420


4427R-2.IR_full       421 TACCACCCACTGTGGAGGACGACTATCCAGAGGCCAATGTGTGGCGCAATCTCAAGTTCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4427R-2.in silico     421 TACCACCCACTGTGGAGGACGACTATCCAGAGGCCAATGTGTGGCGCAATCTCAAGTTCA 480


4427R-2.IR_full       481 AAATGAACAGAAAGCGTGCTGCAGAA 506
                          ||||||||||||||||||||||||||
4427R-2.in silico     481 AAATGAACAGAAAGCGTGCTGCAGAA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164384.1  CG4427-RA, transcript variant A (cbt), mRNA 
87.75   423  NM_134685.2  CG4427-RB, transcript variant B (cbt), mRNA 
0   NM_141003.2  CG3634-RA (CG3634), mRNA 
0   NM_140561.3  CG5931-RA (CG5931), mRNA 
0   NM_136598.2  CG8196-RA (Ance-4), mRNA 
0   NM_138158.2  CG1212-RA, transcript variant A (p130CAS), mRNA 
0   NM_136021.2  CG15152-RA (CG15152), mRNA 
0   NM_139461.1  CG15877-RA (CG15877), mRNA 
0   NM_134479.1  CG14205-RA (CG14205), mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   NM_166612.2  CG30182-RA (CG30182), mRNA 
0   NM_165934.1  CG8776-RA, transcript variant A (CG8776), mRNA 
0   NM_136702.2  CG18445-RA (CG18445), mRNA 
0   NM_080214.2  CG10913-RA (Spn6), mRNA 
0   NM_134494.2  CG12235-RA (Arp11), mRNA 
0   NM_167380.1  CG32628-RA (CG32628), mRNA 
0   NM_001042932.1  CG17494-RB, transcript variant B (CG17494), mRNA 
0   NM_001042933.1  CG17494-RC, transcript variant C (CG17494), mRNA 
0   NM_001042934.1  CG17494-RA, transcript variant A (CG17494), mRNA 
0   NM_139856.2  CG8580-RA, transcript variant A (bhr), mRNA 
0   NM_168211.1  CG8580-RB, transcript variant B (bhr), mRNA 
0   NM_079413.2  CG4345-RA (grim), mRNA 
0   12  NM_079067.2  CG11949-RA, transcript variant A (cora), mRNA 
0   NM_169578.1  CG3307-RC, transcript variant C (pr-set7), mRNA 
0   NM_169577.1  CG3307-RB, transcript variant B (pr-set7), mRNA 
0   NM_142097.2  CG3307-RA, transcript variant A (pr-set7), mRNA 
0   NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   10  NM_057511.3  CG3936-RA (N), mRNA 
0   10  NM_132529.2  CG2025-RA (CG2025), mRNA 
0   NM_166337.1  CG11949-RB, transcript variant B (cora), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.