National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4380R-1 
 Symbol usp  Full Name ultraspiracle 
 CG No CG4380  Old CG No CG4380 
 Synonyms USP, Usp, CF1, CG4380, dUSP, DmUSP, EG:22E5.1, dmUSP, NR2B4, DmUsp, CF1/Usp, CF1/USP, 2C, XR2C, Cf1, l(1)usp, l(1)2Cf, cf1, usp 
 Accession No (Link to NCBI) NM_057433.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Gancz D, Lengil T, Gilboa L.
Coordinated regulation of niche and stem cell precursors by hormonal signaling.
PLoS Biol. (2011) 9(11) e1001202 [ PubMed ID = 22131903 ] [ RRC reference ]

Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCAACTCCGCCAGCTCCAA 
 Primer Seq. 3'
aatctagaggtaccCGCTGCCCATTCCGCCAGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCCAACTCC GCCAGCTCCA ACAACAACAG CGCTGGAGAT GCCCAAATGG CGCAGGCGCC 
0061 CAATTCGGCT GGAGGCTCTG CCGCCgCTGC AGTCCAGCAG CAGTATCCGC CTAACCATCC 
0121 GCTGAGCGGC AGCAAGCACC TCTGCTCTAT TTGCGGGGAT CGGGCCAGTG GCAAGCACTA 
0181 CGGCGTGTAC AGCTGTGAGG GCTGCAAGGG CTTCTTTAAA CGCACAGTGC GCAAGGATCT 
0241 CACATACGCT TGCAGGGAGA ACCGCAACTG CATCATAGAC AAGCGGCAGA GGAACCGCTG 
0301 CCAGTACTGC CGCTACCAGA AGTGCCTAAC CTGCGGCATG AAGCGCGAAG CGGTCCAGGA 
0361 GGAGCGTCAA CGCGNGCGCC CgCAATGCGG CGGGTAGGCT CAGCGCCAGC GGAGGCGGCA 
0421 GTAGCGGTCC AGGTTCGGTA GGCGGATCCA GCTCTCAAGG CGGAGGAGGA GGAGGCGGCG 
0481 TTTCTGGCGG AATGGGCAGC G 
 in silico PCR Fragment
0001 CTCCAACTCC GCCAGCTCCA ACAACAACAG CGCTGGAGAT GCCCAAATGG CGCAGGCGCC 
0061 CAATTCGGCT GGAGGCTCTG CCGCCGCTGC AGTCCAGCAG CAGTATCCGC CTAACCATCC 
0121 GCTGAGCGGC AGCAAGCACC TCTGCTCTAT TTGCGGGGAT CGGGCCAGTG GCAAGCACTA 
0181 CGGCGTGTAC AGCTGTGAGG GCTGCAAGGG CTTCTTTAAA CGCACAGTGC GCAAGGATCT 
0241 CACATACGCT TGCAGGGAGA ACCGCAACTG CATCATAGAC AAGCGGCAGA GGAACCGCTG 
0301 CCAGTACTGC CGCTACCAGA AGTGCCTAAC CTGCGGCATG AAGCGCGAAG CGGTCCAGGA 
0361 GGAGCGTCAA CGCG-GCGCC CGCAATGCGG CGGGTAGGCT CAGCGCCAGC GGAGGCGGCA 
0421 GTAGCGGTCC AGGTTCGGTA GGCGGATCCA GCTCTCAAGG CGGAGGAGGA GGAGGCGGCG 
0481 TTTCTGGCGG AATGGGCAGC G 
 Assemble Data

4380R-1.IR_full       1   CTCCAACTCCGCCAGCTCCAACAACAACAGCGCTGGAGATGCCCAAATGGCGCAGGCGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4380R-1.in silico     1   CTCCAACTCCGCCAGCTCCAACAACAACAGCGCTGGAGATGCCCAAATGGCGCAGGCGCC 60


4380R-1.IR_full       61  CAATTCGGCTGGAGGCTCTGCCGCCGCTGCAGTCCAGCAGCAGTATCCGCCTAACCATCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4380R-1.in silico     61  CAATTCGGCTGGAGGCTCTGCCGCCGCTGCAGTCCAGCAGCAGTATCCGCCTAACCATCC 120


4380R-1.IR_full       121 GCTGAGCGGCAGCAAGCACCTCTGCTCTATTTGCGGGGATCGGGCCAGTGGCAAGCACTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4380R-1.in silico     121 GCTGAGCGGCAGCAAGCACCTCTGCTCTATTTGCGGGGATCGGGCCAGTGGCAAGCACTA 180


4380R-1.IR_full       181 CGGCGTGTACAGCTGTGAGGGCTGCAAGGGCTTCTTTAAACGCACAGTGCGCAAGGATCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4380R-1.in silico     181 CGGCGTGTACAGCTGTGAGGGCTGCAAGGGCTTCTTTAAACGCACAGTGCGCAAGGATCT 240


4380R-1.IR_full       241 CACATACGCTTGCAGGGAGAACCGCAACTGCATCATAGACAAGCGGCAGAGGAACCGCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4380R-1.in silico     241 CACATACGCTTGCAGGGAGAACCGCAACTGCATCATAGACAAGCGGCAGAGGAACCGCTG 300


4380R-1.IR_full       301 CCAGTACTGCCGCTACCAGAAGTGCCTAACCTGCGGCATGAAGCGCGAAGCGGTCCAGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4380R-1.in silico     301 CCAGTACTGCCGCTACCAGAAGTGCCTAACCTGCGGCATGAAGCGCGAAGCGGTCCAGGA 360


4380R-1.IR_full       361 GGAGCGTCAACGCGNGCGCCCGCAATGCGGCGGGTAGGCTCAGCGCCAGCGGAGGCGGCA 420
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
4380R-1.in silico     361 GGAGCGTCAACGCG-GCGCCCGCAATGCGGCGGGTAGGCTCAGCGCCAGCGGAGGCGGCA 420


4380R-1.IR_full       421 GTAGCGGTCCAGGTTCGGTAGGCGGATCCAGCTCTCAAGGCGGAGGAGGAGGAGGCGGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4380R-1.in silico     421 GTAGCGGTCCAGGTTCGGTAGGCGGATCCAGCTCTCAAGGCGGAGGAGGAGGAGGCGGCG 480


4380R-1.IR_full       481 TTTCTGGCGGAATGGGCAGCG 501
                          |||||||||||||||||||||
4380R-1.in silico     481 TTTCTGGCGGAATGGGCAGCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057433.2  CG4380-RA (usp), mRNA 
0.62   10  NM_165903.1  CG30334-RA (CG30334), mRNA 
0.41   18  NM_078726.2  CG4385-RB, transcript variant B (S), mRNA 
0.41   18  NM_164403.1  CG4385-RA, transcript variant A (S), mRNA 
0.2   32  35  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0.2   20  22  NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
0.2   20  22  NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
0.2   20  46  NM_167620.2  CG32547-RA (CG32547), mRNA 
0.2   15  14  NM_137995.2  CG18426-RA (ytr), mRNA 
0.2   12  28  NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0.2   12  28  NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
0.2   11  13  NM_206784.1  CG6103-RE, transcript variant E (CrebB-17A), mRNA 
0.2   11  13  NM_206782.1  CG6103-RD, transcript variant D (CrebB-17A), mRNA 
0.2   11  13  NM_206781.1  CG6103-RF, transcript variant F (CrebB-17A), mRNA 
0.2   11  13  NM_206783.1  CG6103-RG, transcript variant G (CrebB-17A), mRNA 
0.2   NM_142874.2  CG6747-RA (Ir), mRNA 
0.2   17  NM_169843.1  CG31222-RA (CG31222), mRNA 
0.2   26  NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0.2   25  NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0.2   25  NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0.2   25  NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0.2   14  NM_132991.1  CG12432-RA (CG12432), mRNA 
0.2   NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0.2   NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0.2   NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0.2   NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   10  16  NM_165465.1  CG1765-RB, transcript variant B (EcR), mRNA 
0   10  13  NM_165461.1  CG1765-RA, transcript variant A (EcR), mRNA 
0   10  13  NM_165464.1  CG1765-RC, transcript variant C (EcR), mRNA 
0   10  13  NM_165463.1  CG1765-RE, transcript variant E (EcR), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.