National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4376R-1 
 Symbol Actn  Full Name alpha actinin 
 CG No CG4376  Old CG No CG4376 
 Synonyms l(1)2Cb, fliA, actn, EG:133E12.1, CG4376, CT14232, CT14163, HM-29, GA17, l(1)EA82, alpha-actinin, y, Actn 
 Accession No (Link to NCBI) NM_058136.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACATGGAGCAGGAGGAGGAG 
 Primer Seq. 3'
aatctagaggtaccGCCAGACCATCCTTGAACGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACATGGAGC AGGAGGAGGA GTGGGAGCGC GAGGGCCTGC TCGATCCTGC GTGGGAGAAG 
0061 CAACAGAAGA AGACATTTAC CGCCTGGTGT AACAGCCATT TGCGCAAGGC CGGTACAGCC 
0121 ATCGACAACA TCGAGGAGGA CTTCCGCAAC GGCCTCAAGC TGATGCTGCT GCTGGAGGTG 
0181 ATCTCCGGCG AGACGCTCCC CAAGCCCGAT CGCGGCAAGA TGCGCTTCCA CAAGATCGCC 
0241 AACGTGAACA AGGCTCTCGA CTTCATCGCC TCCAAGGGCG TCCACCTGGT CTCTATCGGC 
0301 GCCGAGGAGA TCGTCGATGG AAACTTGAAG ATGACTCTGG GTATGATCTG GACGATTATC 
0361 CTGCGCTTCG CCATTCAGGA CATCTCCGTG GAGGAGATGA CCGCCAAGGA GGGTCTGCTG 
0421 CTGTGGTGCC AGCGCAAGAC GGCTCCCTAC AAGAACGTCA ACGTACAGAA CTTCCATCTG 
0481 TCGTTCAAGG ATGGTCTGGC  
 in silico PCR Fragment
0001 TACATGGAGC AGGAGGAGGA GTGGGAGCGC GAGGGCCTGC TCGATCCTGC GTGGGAGAAG 
0061 CAACAGAAGA AGACATTTAC CGCCTGGTGT AACAGCCATT TGCGCAAGGC CGGTACAGCC 
0121 ATCGACAACA TCGAGGAGGA CTTCCGCAAC GGCCTCAAGC TGATGCTGCT GCTGGAGGTG 
0181 ATCTCCGGCG AGACGCTCCC CAAGCCCGAT CGCGGCAAGA TGCGCTTCCA CAAGATCGCC 
0241 AACGTGAACA AGGCTCTCGA CTTCATCGCC TCCAAGGGCG TCCACCTGGT CTCTATCGGC 
0301 GCCGAGGAGA TCGTCGATGG AAACTTGAAG ATGACTCTGG GTATGATCTG GACGATTATC 
0361 CTGCGCTTCG CCATTCAGGA CATCTCCGTG GAGGAGATGA CCGCCAAGGA GGGTCTGCTG 
0421 CTGTGGTGCC AGCGCAAGAC GGCTCCCTAC AAGAACGTCA ACGTACAGAA CTTCCATCTG 
0481 TCGTTCAAGG ATGGTCTGGC  
 Assemble Data

4376R-1.IR_full       1   TACATGGAGCAGGAGGAGGAGTGGGAGCGCGAGGGCCTGCTCGATCCTGCGTGGGAGAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4376R-1.in silico     1   TACATGGAGCAGGAGGAGGAGTGGGAGCGCGAGGGCCTGCTCGATCCTGCGTGGGAGAAG 60


4376R-1.IR_full       61  CAACAGAAGAAGACATTTACCGCCTGGTGTAACAGCCATTTGCGCAAGGCCGGTACAGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4376R-1.in silico     61  CAACAGAAGAAGACATTTACCGCCTGGTGTAACAGCCATTTGCGCAAGGCCGGTACAGCC 120


4376R-1.IR_full       121 ATCGACAACATCGAGGAGGACTTCCGCAACGGCCTCAAGCTGATGCTGCTGCTGGAGGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4376R-1.in silico     121 ATCGACAACATCGAGGAGGACTTCCGCAACGGCCTCAAGCTGATGCTGCTGCTGGAGGTG 180


4376R-1.IR_full       181 ATCTCCGGCGAGACGCTCCCCAAGCCCGATCGCGGCAAGATGCGCTTCCACAAGATCGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4376R-1.in silico     181 ATCTCCGGCGAGACGCTCCCCAAGCCCGATCGCGGCAAGATGCGCTTCCACAAGATCGCC 240


4376R-1.IR_full       241 AACGTGAACAAGGCTCTCGACTTCATCGCCTCCAAGGGCGTCCACCTGGTCTCTATCGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4376R-1.in silico     241 AACGTGAACAAGGCTCTCGACTTCATCGCCTCCAAGGGCGTCCACCTGGTCTCTATCGGC 300


4376R-1.IR_full       301 GCCGAGGAGATCGTCGATGGAAACTTGAAGATGACTCTGGGTATGATCTGGACGATTATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4376R-1.in silico     301 GCCGAGGAGATCGTCGATGGAAACTTGAAGATGACTCTGGGTATGATCTGGACGATTATC 360


4376R-1.IR_full       361 CTGCGCTTCGCCATTCAGGACATCTCCGTGGAGGAGATGACCGCCAAGGAGGGTCTGCTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4376R-1.in silico     361 CTGCGCTTCGCCATTCAGGACATCTCCGTGGAGGAGATGACCGCCAAGGAGGGTCTGCTG 420


4376R-1.IR_full       421 CTGTGGTGCCAGCGCAAGACGGCTCCCTACAAGAACGTCAACGTACAGAACTTCCATCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4376R-1.in silico     421 CTGTGGTGCCAGCGCAAGACGGCTCCCTACAAGAACGTCAACGTACAGAACTTCCATCTG 480


4376R-1.IR_full       481 TCGTTCAAGGATGGTCTGGC 500
                          ||||||||||||||||||||
4376R-1.in silico     481 TCGTTCAAGGATGGTCTGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
100   482  NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
100   482  NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0.62   27  NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0.62   27  NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0.62   27  NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0.41   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   20  NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   11  NM_142889.1  CG4374-RA (CG4374), mRNA 
0   12  NM_078827.1  CG4977-RA (kek2), mRNA 
0   41  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   14  NM_132606.1  CG3754-RA (CG3754), mRNA 
0   14  NM_001038916.1  CG17689-RB, transcript variant B (CG17689), mRNA 
0   NM_143352.1  CG12870-RA (CG12870), mRNA 
0   11  36  NM_170258.2  CG32474-RA (dys), mRNA 
0   23  NM_057891.2  CG3365-RB, transcript variant B (drongo), mRNA 
0   23  NM_164392.1  CG3365-RC, transcript variant C (drongo), mRNA 
0   23  NM_164391.1  CG3365-RA, transcript variant A (drongo), mRNA 
0   13  NM_167844.1  CG32479-RA (CG32479), mRNA 
0   13  NM_170659.1  CG7835-RA (CG7835), mRNA 
0   NM_132272.1  CG11294-RA (CG11294), mRNA 
0   NM_135110.1  CG11147-RA, transcript variant A (CG11147), mRNA 
0   NM_164658.1  CG11147-RB, transcript variant B (CG11147), mRNA 
0   NM_168881.1  CG32434-RB, transcript variant B (siz), mRNA 
0   NM_206407.1  CG32434-RA, transcript variant A (siz), mRNA 
0   NM_001043153.1  CG32434-RC, transcript variant C (siz), mRNA 
0   11  NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   11  NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   64  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   47  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.