National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4353R-3 
 Symbol hep  Full Name hemipterous 
 CG No CG4353  Old CG No CG4353 
 Synonyms HEP/MKK7, DJNKK, HEP, JNKK, MKK7, DHEP/MKK7, CG2190, CG4353, DMKK7, hp, l(1)G0107, l(1)G0208, l(1)7P1, hem, hep, Hep 
 Accession No (Link to NCBI) NM_167346.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Neisch AL, Speck O, Stronach B, Fehon RG.
Rho1 regulates apoptosis via activation of the JNK signaling pathway at the plasma membrane.
J. Cell Biol. (2010) 189(2) 311-23 [ PubMed ID = 20404112 ] [ RRC reference ]

Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACCTTCCTTGGGCGCAGGTTCCGTTTCCGGATCGGGTATCAGCATAGCCCAGCGTCCAG- 60

                           |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| silico     61  -CACCTCCAGTTCCTCA-TGCGACGCCCTTCGGCAGCGCCAGCGCCTCGTCATCATCCTC 120

                          ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| silico     121 ATCCGCATCCGCATTTGCATCCGCAGCACCGGCGACGGGCACCT-TCGGTGGAACATACA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCCGCCGACAACTAGAGTGTCGCGAGCCACGCCCACACTGCCCATGCTTTCTAGTGGTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCGGTGGTGGACTGAATCGTACGCGGCCGGTGATACTTCCGCTGCCCACGCCGCCACATC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTCCAGTTTCGGAAACGGACATGAAGCTGAAGATCATCATGGAGCAGACCGGCAAGCTGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACATCAACGGGCGGCAGTATCCGACGGACATCAATGACCTCAAGCACCTGGGCGACCTGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCAATGGGACTAGCGGCAATGTGGTGAAGATGATGCACCTGTCCAGCAACACGATCATCG 480

4353R-3.IR_full       481 CCGTGAAGCAGATGNGACGCACTG 504
                          |||||||||||||| ||||||||| silico     481 CCGTGAAGCAGATGCGACGCACTG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  26  NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
100   482  24  NM_078587.2  CG4353-RC, transcript variant C (hep), mRNA 
0.62   34  NM_001032002.1  CG33676-RA, transcript variant A (Skeletor), mRNA 
0.62   34  NM_001032000.1  CG14681-RB, transcript variant B (CG14681), mRNA 
0.2   NM_139694.2  CG4603-RA (CG4603), mRNA 
0.2   NM_135184.2  CG9528-RA (retm), mRNA 
0   13  24  NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0   13  24  NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0   10  36  NM_080531.2  CG5481-RA (lea), mRNA 
0   14  NM_078740.2  CG8817-RB, transcript variant B (lilli), mRNA 
0   14  NM_164516.1  CG8817-RA, transcript variant A (lilli), mRNA 
0   14  NM_164517.1  CG8817-RC, transcript variant C (lilli), mRNA 
0   10  NM_136649.1  CG12932-RA (CG12932), mRNA 
0   NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   NM_057792.2  CG9019-RA (dsf), mRNA 
0   NM_136290.2  CG6448-RB, transcript variant B (CG6448), mRNA 
0   NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 
0   20  77  NM_058124.2  CG5772-RA (Sur), mRNA 
0   16  NM_176723.2  CG33175-RG, transcript variant G (spri), mRNA 
0   16  NM_206678.1  CG33175-RA, transcript variant A (spri), mRNA 
0   14  NM_165490.1  CG3427-RA (Epac), mRNA 
0   NM_079356.2  CG18492-RA (Tak1), mRNA 
0   18  NM_080306.2  CG3443-RB (pcx), mRNA 
0   18  NM_143001.1  CG17781-RA (CG17781), mRNA 
0   NM_134874.2  CG2973-RA (CG2973), mRNA 
0   NM_143200.1  CG14549-RA (Sld5), mRNA 
0   NM_170347.1  CG31055-RC, transcript variant C (CG31055), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.