National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4353R-2 
 Symbol hep  Full Name hemipterous 
 CG No CG4353  Old CG No CG4353 
 Synonyms HEP/MKK7, DJNKK, HEP, JNKK, MKK7, DHEP/MKK7, CG2190, CG4353, DMKK7, hp, l(1)G0107, l(1)G0208, l(1)7P1, hem, hep, Hep 
 Accession No (Link to NCBI) NM_167346.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Demay Y, Perochon J, Szuplewski S, Mignotte B, Gaumer S.
The PERK pathway independently triggers apoptosis and a Rac1/Slpr/JNK/Dilp8 signaling favoring tissue homeostasis in a chronic ER stress Drosophila model.
Cell Death Dis (2014) 5 e1452 [ PubMed ID = 25299777 ] [ RRC reference ]

Clavier A, Rincheval-Arnold A, Baillet A, Mignotte B, Guénal I.
Two different specific JNK activators are required to trigger apoptosis or compensatory proliferation in response to Rbf1 in Drosophila.
Cell Cycle (2016) 15(2) 283-94 [ PubMed ID = 26825229 ] [ RRC reference ]

Clavier A, Ruby V, Rincheval-Arnold A, Mignotte B, Guénal I.
The Drosophila retinoblastoma protein, Rbf1, induces a Debcl- and Drp1-dependent mitochondrial apoptosis.
J. Cell. Sci. (2015) 128(17) 3239-49 [ PubMed ID = 26208635 ] [ RRC reference ]

Marchal C, Vinatier G, Sanial M, Plessis A, Pret AM, Limbourg-Bouchon B, Théodore L, Netter S.
The HIV-1 Vpu protein induces apoptosis in Drosophila via activation of JNK signaling.
PLoS ONE (2012) 7(3) e34310 [ PubMed ID = 22479597 ] [ RRC reference ]

Chang YC, Tu H, Chen JY, Chang CC, Yang SY, Pi H.
Reproduction disrupts stem cell homeostasis in testes of aged male Drosophila via an induced microenvironment.
PLoS Genet. (2019) 15(7) e1008062 [ PubMed ID = 31295251 ] [ RRC reference ]

Neisch AL, Speck O, Stronach B, Fehon RG.
Rho1 regulates apoptosis via activation of the JNK signaling pathway at the plasma membrane.
J. Cell Biol. (2010) 189(2) 311-23 [ PubMed ID = 20404112 ] [ RRC reference ]

Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACCTTCCTTGGGCGCAGGTTCCGTTTCCGGATCGGGTATCAGCATAGCCCAGCGTCCAG- 60

                           |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| silico     61  -CACCTCCAGTTCCTCA-TGCGACGCCCTTCGGCAGCGCCAGCGCCTCGTCATCATCCTC 120

                          ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| silico     121 ATCCGCATCCGCATTTGCATCCGCAGCACCGGCGACGGGCACCT-TCGGTGGAACATACA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCCGCCGACAACTAGAGTGTCGCGAGCCACGCCCACACTGCCCATGCTTTCTAGTGGTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCGGTGGTGGACTGAATCGTACGCGGCCGGTGATACTTCCGCTGCCCACGCCGCCACATC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTCCAGTTTCGGAAACGGACATGAAGCTGAAGATCATCATGGAGCAGACCGGCAAGCTGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACATCAACGGGCGGCAGTATCCGACGGACATCAATGACCTCAAGCACCTGGGCGACCTGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCAATGGGACTAGCGGCAATGTGGTGAAGATGATGCACCTGTCCAGCAACACGATCATCG 480

4353R-2.IR_full       481 CCGTGAAGCAGATGNGACGCACTG 504
                          |||||||||||||| ||||||||| silico     481 CCGTGAAGCAGATGCGACGCACTG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  26  NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
100   482  24  NM_078587.2  CG4353-RC, transcript variant C (hep), mRNA 
0.62   34  NM_001032002.1  CG33676-RA, transcript variant A (Skeletor), mRNA 
0.62   34  NM_001032000.1  CG14681-RB, transcript variant B (CG14681), mRNA 
0.2   NM_139694.2  CG4603-RA (CG4603), mRNA 
0.2   NM_135184.2  CG9528-RA (retm), mRNA 
0   13  24  NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0   13  24  NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0   10  36  NM_080531.2  CG5481-RA (lea), mRNA 
0   14  NM_078740.2  CG8817-RB, transcript variant B (lilli), mRNA 
0   14  NM_164516.1  CG8817-RA, transcript variant A (lilli), mRNA 
0   14  NM_164517.1  CG8817-RC, transcript variant C (lilli), mRNA 
0   10  NM_136649.1  CG12932-RA (CG12932), mRNA 
0   NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   NM_057792.2  CG9019-RA (dsf), mRNA 
0   NM_136290.2  CG6448-RB, transcript variant B (CG6448), mRNA 
0   NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 
0   20  77  NM_058124.2  CG5772-RA (Sur), mRNA 
0   16  NM_176723.2  CG33175-RG, transcript variant G (spri), mRNA 
0   16  NM_206678.1  CG33175-RA, transcript variant A (spri), mRNA 
0   14  NM_165490.1  CG3427-RA (Epac), mRNA 
0   NM_079356.2  CG18492-RA (Tak1), mRNA 
0   18  NM_080306.2  CG3443-RB (pcx), mRNA 
0   18  NM_143001.1  CG17781-RA (CG17781), mRNA 
0   NM_134874.2  CG2973-RA (CG2973), mRNA 
0   NM_143200.1  CG14549-RA (Sld5), mRNA 
0   NM_170347.1  CG31055-RC, transcript variant C (CG31055), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.