National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4351R-2 
 Symbol CG4351  Full Name CG4351 
 CG No CG4351  Old CG No CG4351 
 Synonyms CG4351 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTCAGAGTTGGGTATACGGG 
 Primer Seq. 3'
aatctagaggtaccGACGCTGCTGCTGAGCAGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

4351R-2.IR full       1   CCTCAGAGTTGGGTATACGGGAGAAGCTCTTCATCGGGGTGATGACCTCGCAGGAGCACA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4351R-2.in silico     1   CCTCAGAGTTGGGTATACGGGAGAAGCTCTTCATCGGGGTGATGACCTCGCAGGAGCACA 60


4351R-2.IR full       61  TCAACACCTTTGCGACGGCCTTCAACCGCACCACCGCCCACCTGGTGAACAAGATNAAGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
4351R-2.in silico     61  TCAACACCTTTGCGACGGCCTTCAACCGCACCACCGCCCACCTGGTGAACAAGATCAAGT 120


4351R-2.IR full       121 TCTTCATTTATGCGGACAGTGTAAAGACCAACTACAAGCTGAAGAACATCGTGGGATTTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4351R-2.in silico     121 TCTTCATTTATGCGGACAGTGTAAAGACCAACTACAAGCTGAAGAACATCGTGGGATTTA 180


4351R-2.IR full       181 CGGACACGCGGGAGAGTCGCCGGCCATTCCACGTGGTCAAGTATATTGCGGACAACTATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4351R-2.in silico     181 CGGACACGCGGGAGAGTCGCCGGCCATTCCACGTGGTCAAGTATATTGCGGACAACTATC 240


4351R-2.IR full       241 TGGATGAGTACGATTATTTCCTGNTGGTGCCCGATACCGTCTACGTGGATGCGCGTAAGC 300
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
4351R-2.in silico     241 TGGATGAGTACGATTATTTCCTGTTGGTGCCCGATACCGTCTACGTGGATGCGCGTAAGC 300


4351R-2.IR full       301 TGGTGAAGTTGCTCTATCACATGAGCATCACCTTTGACCTGTACATGGGTGGCGCNCGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
4351R-2.in silico     301 TGGTGAAGTTGCTCTATCACATGAGCATCACCTTTGACCTGTACATGGGTGGCGCACGCA 360


4351R-2.IR full       361 TCGGCCTGGATCCTTCGGGNTTCGGTNNCTNCCCCGATGGCCAGTCGAATGAACCGCCGG 420
                          |||||||||||||||||||   ||||  || | |||||||||||||||||||||||||||
4351R-2.in silico     361 TCGGCCTGGATCCTTCGGGTGGCGGTGCCTCCGCCGATGGCCAGTCGAATGAACCGCCGG 420


4351R-2.IR full       421 CGAACGAGGAGGAGGCACCCGGAGCCAGTGATCGCAACTATTGCTCCTTGGAGGCGG-CA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
4351R-2.in silico     421 CGAACGAGGAGGAGGCACCCGGAGCCAGTGATCGCAACTATTGCTCCTTGGAGGCGGGCA 480


4351R-2.IR full       481 TTNCGCTCAGCAGCAGCGTC 500
                          ||  ||||||||||||||||
4351R-2.in silico     481 TTCTGCTCAGCAGCAGCGTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_132625.1  CG4351-RA (CG4351), mRNA 
NM_170330.1  lethal (3) malignant brain tumor CG5954-RB, transcript variant B (l(3)mbt), mRNA 
NM_079805.2  lethal (3) malignant brain tumor CG5954-RA, transcript variant A (l(3)mbt), mRNA 
NM_057406.3  suppressor of sable CG6222-RA (su(s)), mRNA 
NM_136154.1  CG10631-RA (CG10631), mRNA 
NM_167445.2  CG6294-RA (CG6294), mRNA 
NM_176733.2  CG6299-RB, transcript variant B (CG6299), mRNA 
NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
NM_057218.3  Glycerol 3 phosphate dehydrogenase CG9042-RC, transcript variant C (Gpdh), mRNA 
NM_057217.3  Glycerol 3 phosphate dehydrogenase CG9042-RB, transcript variant B (Gpdh), mRNA 
NM_057219.3  Glycerol 3 phosphate dehydrogenase CG9042-RA, transcript variant A (Gpdh), mRNA 
NM_176138.3  longitudinals lacking CG12052-RL, transcript variant L (lola), mRNA 
NM_206084.2  longitudinals lacking CG12052-RW, transcript variant W (lola), mRNA 
NM_176128.3  longitudinals lacking CG12052-RN, transcript variant N (lola), mRNA 
NM_170621.3  longitudinals lacking CG12052-RE, transcript variant E (lola), mRNA 
NM_176130.3  longitudinals lacking CG12052-RJ, transcript variant J (lola), mRNA 
NM_170620.2  longitudinals lacking CG12052-RD, transcript variant D (lola), mRNA 
NM_176137.3  longitudinals lacking CG12052-RS, transcript variant S (lola), mRNA 
NM_001032229.1  longitudinals lacking CG12052-RZ, transcript variant Z (lola), mRNA 
NM_170623.4  longitudinals lacking CG12052-RA, transcript variant A (lola), mRNA 
NM_176139.2  longitudinals lacking CG12052-RQ, transcript variant Q (lola), mRNA 
NM_206085.2  longitudinals lacking CG12052-RV, transcript variant V (lola), mRNA 
NM_176140.2  longitudinals lacking CG12052-RM, transcript variant M (lola), mRNA 
NM_176136.3  longitudinals lacking CG12052-RK, transcript variant K (lola), mRNA 
NM_170622.4  longitudinals lacking CG12052-RF, transcript variant F (lola), mRNA 
NM_176135.3  longitudinals lacking CG12052-RU, transcript variant U (lola), mRNA 
NM_176134.2  longitudinals lacking CG12052-RT, transcript variant T (lola), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.