National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4322R-1 
 Symbol moody  Full Name moody 
 CG No CG4322  Old CG No CG4322 
 Synonyms 1631, EG:22E5.11, EP1631, unnamed, moody, CG4322 
 Accession No (Link to NCBI) NM_130614.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Xu C, Franklin B, Tang HW, Regimbald-Dumas Y, Hu Y, Ramos J, Bosch JA, Villalta C, He X, Perrimon N.
An in vivo RNAi screen uncovers the role of AdoR signaling and adenosine deaminase in controlling intestinal stem cell activity.
Proc. Natl. Acad. Sci. U.S.A. (2019) [ PubMed ID = 31852821 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGCTGTTCTCCTACGGCAT 
 Primer Seq. 3'
aatctagaggtaccGGCCAGCACCATCTTAGTGAT 
 Predicted Fragment Size
472 
 IR fragment full Seq
0001 NTGGCTGTTC TCCTACGGCA TGCAGCTCCC GACGCTTCTG GGAGAGTGGG GTCGCTTTGG 
0061 CTACGACTCG AGATTACAGA CCTGCTCCAT CATGACCGAC GACCATGGGC ACAGCAGCAA 
0121 GACGACGTTG TTTATCACCG CCTTCGTCAT CCCTTGCCTA GTTATAATTG CCTGCTATGC 
0181 CAAGATCTTC TGGGTGGTCC ACAAGTCGGA GCAGCGCTTG AAGCGCCATG CGACCAATAC 
0241 AAAACTCCAT ACCCAACAAC CTGCGCCCCC TAGCCTCTAC AGGATCAGGA GCCCTGCCCT 
0301 CCGGCGCGGA ATGCCAGCCA AGCAACCGCG TCTCCTCGGA CAGCAGCAGT AGCTTCTCTC 
0361 ATCGATGTGC CGGAGACAGC GCCCAGCGGC TAAGCAGCAG CCAACCCGAG TCAAGGATCA 
0421 GCGTGAAGTA CGTGCCAAGC GAAACGAGTG GCGCATCACT AAGATGGTGC TGGCC 
 in silico PCR Fragment
0001 CTGGCTGTTC TCCTACGGCA TGCAGCTCCC GACGCTTCTG GGAGAGTGGG GTCGCTTTGG 
0061 CTACGACTCG AGATTACAGA CCTGCTCCAT CATGACCGAC GACCATGGGC ACAGCAGCAA 
0121 GACGACGTTG TTTATCACCG CCTTCGTCAT CCCTTGCCTG GTTATCATTG CCTGCTATGC 
0181 CAAGATCTTC TGGGTGGTCC ACAAGTCGGA GCAGCGCTTG AAGCGCCATG CCACCAA-AC 
0241 AAAACTCCAT ACCCAACAAC CTCCGCCCCC TAGCCTCTAC AGGATCAGGA GCCCTGCCCT 
0301 CCGGCGCGGA ATGCCAGCCA AGCAACCGCG TCTCCTCGGA CAGCAGCAGT AGCTTCTC-C 
0361 ATCGATGTGC CGGAGACAGC GCCCAGCGGC -AAGCAGCAG CCAACCCGAG TCAAGGATCA 
0421 GCGTGAAGTA CGTGCCAAGC GAAACGAGTG GCGCATCACT AAGATGGTGC TGGCC 
 Assemble Data

4322R-1.IR_full        1   TGGCTGTTCTCCTACGGCATGCAGCTCCCGACGCTTCTGGGAGAGTGGGGTCGCTTTGG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4322R-1.in silico      1   TGGCTGTTCTCCTACGGCATGCAGCTCCCGACGCTTCTGGGAGAGTGGGGTCGCTTTGG 59


4322R-1.IR_full       61  CTACGACTCGAGATTACAGACCTGCTCCATCATGACCGACGACCATGGGCACAGCAGCAA 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4322R-1.in silico     61  CTACGACTCGAGATTACAGACCTGCTCCATCATGACCGACGACCATGGGCACAGCAGCAA 119


4322R-1.IR_full       121 GACGACGTTGTTTATCACCGCCTTCGTCATCCCTTGCCTAGTTATAATTGCCTGCTATGC 179
                          ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||
4322R-1.in silico     121 GACGACGTTGTTTATCACCGCCTTCGTCATCCCTTGCCTGGTTATCATTGCCTGCTATGC 179


4322R-1.IR_full       181 CAAGATCTTCTGGGTGGTCCACAAGTCGGAGCAGCGCTTGAAGCGCCATGCGACCAATAC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||
4322R-1.in silico     181 CAAGATCTTCTGGGTGGTCCACAAGTCGGAGCAGCGCTTGAAGCGCCATGCCACCAA-AC 239


4322R-1.IR_full       241 AAAACTCCATACCCAACAACCTGCGCCCCCTAGCCTCTACAGGATCAGGAGCCCTGCCCT 299
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
4322R-1.in silico     241 AAAACTCCATACCCAACAACCTCCGCCCCCTAGCCTCTACAGGATCAGGAGCCCTGCCCT 299


4322R-1.IR_full       301 CCGGCGCGGAATGCCAGCCAAGCAACCGCGTCTCCTCGGACAGCAGCAGTAGCTTCTCTC 359
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
4322R-1.in silico     301 CCGGCGCGGAATGCCAGCCAAGCAACCGCGTCTCCTCGGACAGCAGCAGTAGCTTCTC-C 359


4322R-1.IR_full       361 ATCGATGTGCCGGAGACAGCGCCCAGCGGCTAAGCAGCAGCCAACCCGAGTCAAGGATCA 419
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
4322R-1.in silico     361 ATCGATGTGCCGGAGACAGCGCCCAGCGGC-AAGCAGCAGCCAACCCGAGTCAAGGATCA 419


4322R-1.IR_full       421 GCGTGAAGTACGTGCCAAGCGAAACGAGTGGCGCATCACTAAGATGGTGCTGGCC 474
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||
4322R-1.in silico     421 GCGTGAAGTACGTGCCAAGCGAAACGAGTGGCGCATCACTAAGATGGTGCTGGCC 474

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   454  NM_130614.2  CG4322-RA (CG4322), mRNA 
0   NM_079665.2  CG7623-RA (sll), mRNA 
0   NM_001043123.1  CG32387-RC, transcript variant C (CG32387), mRNA 
0   NM_168195.1  CG32387-RB, transcript variant B (CG32387), mRNA 
0   NM_176181.1  CG8291-RC, transcript variant C (CG8291), mRNA 
0   NM_137220.2  CG8291-RA, transcript variant A (CG8291), mRNA 
0   NM_166121.2  CG8291-RB, transcript variant B (CG8291), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_138026.3  CG3907-RB, transcript variant B (CG3907), mRNA 
0   NM_166647.2  CG3907-RA, transcript variant A (CG3907), mRNA 
0   NM_168470.1  CG32085-RA (CG32085), mRNA 
0   NM_079017.2  CG8542-RA (Hsc70-5), mRNA 
0   NM_137819.2  CG11206-RA, transcript variant A (CG11206), mRNA 
0   NM_206200.1  CG11206-RB, transcript variant B (CG11206), mRNA 
0   NM_176108.1  CG8080-RA (CG8080), mRNA 
0   NM_079694.2  CG5460-RC, transcript variant C (H), mRNA 
0   NM_169907.1  CG5460-RA, transcript variant A (H), mRNA 
0   NM_169908.1  CG5460-RD, transcript variant D (H), mRNA 
0   NM_169909.1  CG5460-RB, transcript variant B (H), mRNA 
0   NM_167279.1  CG18361-RB, transcript variant B (dsh), mRNA 
0   NM_078563.2  CG18361-RA, transcript variant A (dsh), mRNA 
0   NM_137032.2  CG5970-RA (CG5970), mRNA 
0   NM_001038794.1  CG34010-RA (CG34010), mRNA 
0   NM_176435.1  CG8176-RA, transcript variant A (CG8176), mRNA 
0   NM_176436.1  CG8176-RB, transcript variant B (CG8176), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_001014540.1  CG8201-RN, transcript variant N (par-1), mRNA 
0   NM_001014542.1  CG8201-RL, transcript variant L (par-1), mRNA 
0   NM_206178.1  CG8201-RA, transcript variant A (par-1), mRNA 
0   NM_206177.1  CG8201-RB, transcript variant B (par-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.