National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4316R-1 
 Symbol Sb  Full Name Stubble 
 CG No CG4316  Old CG No CG4316 
 Synonyms sbd, SP56, c-SP56, st-sb, Sb-sbd, CG4316, Sb 
 Accession No (Link to NCBI) NM_057361.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ibrahim DM, Biehs B, Kornberg TB, Klebes A.
Microarray comparison of anterior and posterior Drosophila wing imaginal disc cells identifies novel wing genes.
G3 (Bethesda) (2013) 3(8) 1353-62 [ PubMed ID = 23749451 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTAGCGGCTTCTACCGCATC 
 Primer Seq. 3'
aatctagaggtaccGAGCTGGAACTGGAGCTGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTAGCGGCT TCTACCGCAT CCCGCACCGC CTGGAgGGNT ATCCGCAGTT GCAGCAACTG 
0061 CAGCGCGGCC AGAACTTCAA GATCAGCCCC AAGCCATGCT CCTTTGGCCG CGTCGAGGGC 
0121 ACCTGCATGT TCGTGTGGGA GTGCATCAAG TCCGAGGGCA AGCACGTGGG CATGTGCGTC 
0181 GACTCCTTCA TGTTCGGCTC CTGCTGCACG CACAACTACA CCGACAACAT TGTCCTGCCC 
0241 CAGACGGCCT TCTCCTACAC GAGGCCCACC ANAGCCGCTC ACGCTCCGCC CGCGACCGCC 
0301 GGCAGCGCCC TACAAGCCGA TGATCAGCGG CATGACCACC ATCGAGAGGC CTCATGGCGC 
0361 TGGCACCCTT GTGATTCGTC CTTCGGGTCC GCACCACCAG GGCACTCTGG CCCGCCCGCA 
0421 TCCGCCGCCC TACCAGAGCA AGCCCACCAC TGCCTCGGAT CTGCATGGCT CAGCNTCGCA 
0481 TCCCAGCTCC AGTTCCAGCT c 
 in silico PCR Fragment
0001 AGTAGCGGCT TCTACCGCAT CCCGCACCGC CTGGAGGGCT ATCCGCAGTT GCAGCAACTG 
0061 CAGCGCGGCC AGAACTTCAA GATCAGCCCC AAGCCATGCT CCTTTGGCCG CGTCGAGGGC 
0121 ACCTGCATGT TCGTGTGGGA GTGCATCAAG TCCGAGGGCA AGCACGTGGG CATGTGCGTC 
0181 GACTCCTTCA TGTTCGGCTC CTGCTGCACG CACAACTACA CCGACAACAT TGTCCTGCCC 
0241 CAGACGGCCT TCTCCTACAC GAGGCCCACC A-AGCCGCTC ACGCTCCGCC CGCGACCGCC 
0301 GGCAGCGCCC TACAAGCCGA TGATCAGCGG CATGACCACC ATCGAGAGGC CTCATGGCGC 
0361 TGGCACCCTT GTGATTCGTC CTTCGGGTCC GCACCACCAG GGCACTCTGG CCCGCCCGCA 
0421 TCCGCCGCCC TACCAGAGCA AGCCCACCAC TGCCTCGGAT CTGCATGGCT CAGCCTCGCA 
0481 TCCCAGCTCC AGTTCCAGCT C 
 Assemble Data

4316R-1.IR_full       1   AGTAGCGGCTTCTACCGCATCCCGCACCGCCTGGAGGGNTATCCGCAGTTGCAGCAACTG 60
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
4316R-1.in silico     1   AGTAGCGGCTTCTACCGCATCCCGCACCGCCTGGAGGGCTATCCGCAGTTGCAGCAACTG 60


4316R-1.IR_full       61  CAGCGCGGCCAGAACTTCAAGATCAGCCCCAAGCCATGCTCCTTTGGCCGCGTCGAGGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4316R-1.in silico     61  CAGCGCGGCCAGAACTTCAAGATCAGCCCCAAGCCATGCTCCTTTGGCCGCGTCGAGGGC 120


4316R-1.IR_full       121 ACCTGCATGTTCGTGTGGGAGTGCATCAAGTCCGAGGGCAAGCACGTGGGCATGTGCGTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4316R-1.in silico     121 ACCTGCATGTTCGTGTGGGAGTGCATCAAGTCCGAGGGCAAGCACGTGGGCATGTGCGTC 180


4316R-1.IR_full       181 GACTCCTTCATGTTCGGCTCCTGCTGCACGCACAACTACACCGACAACATTGTCCTGCCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4316R-1.in silico     181 GACTCCTTCATGTTCGGCTCCTGCTGCACGCACAACTACACCGACAACATTGTCCTGCCC 240


4316R-1.IR_full       241 CAGACGGCCTTCTCCTACACGAGGCCCACCANAGCCGCTCACGCTCCGCCCGCGACCGCC 300
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
4316R-1.in silico     241 CAGACGGCCTTCTCCTACACGAGGCCCACCA-AGCCGCTCACGCTCCGCCCGCGACCGCC 300


4316R-1.IR_full       301 GGCAGCGCCCTACAAGCCGATGATCAGCGGCATGACCACCATCGAGAGGCCTCATGGCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4316R-1.in silico     301 GGCAGCGCCCTACAAGCCGATGATCAGCGGCATGACCACCATCGAGAGGCCTCATGGCGC 360


4316R-1.IR_full       361 TGGCACCCTTGTGATTCGTCCTTCGGGTCCGCACCACCAGGGCACTCTGGCCCGCCCGCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4316R-1.in silico     361 TGGCACCCTTGTGATTCGTCCTTCGGGTCCGCACCACCAGGGCACTCTGGCCCGCCCGCA 420


4316R-1.IR_full       421 TCCGCCGCCCTACCAGAGCAAGCCCACCACTGCCTCGGATCTGCATGGCTCAGCNTCGCA 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
4316R-1.in silico     421 TCCGCCGCCCTACCAGAGCAAGCCCACCACTGCCTCGGATCTGCATGGCTCAGCCTCGCA 480


4316R-1.IR_full       481 TCCCAGCTCCAGTTCCAGCTC 501
                          |||||||||||||||||||||
4316R-1.in silico     481 TCCCAGCTCCAGTTCCAGCTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  NM_057361.3  CG4316-RA (Sb), mRNA 
0.2   NM_058149.3  CG3352-RA (ft), mRNA 
0   11  NM_130640.1  CG2879-RA (CG2879), mRNA 
0   14  NM_131995.1  CG15784-RA (CG15784), mRNA 
0   NM_140744.1  CG6064-RA (TORC), mRNA 
0   NM_132443.1  CG16922-RA (CG16922), mRNA 
0   NM_140249.1  CG14131-RA (CG14131), mRNA 
0   13  NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   11  NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_139501.2  CG2114-RA (FR), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_079375.2  CG5949-RA (DNApol-delta), mRNA 
0   NM_170325.1  CG31064-RA, transcript variant A (CG31064), mRNA 
0   NM_143288.2  CG31064-RE, transcript variant E (CG31064), mRNA 
0   NM_001038767.1  CG34019-RA (CG34019), mRNA 
0   NM_165643.1  CG8073-RB, transcript variant B (Pmm45A), mRNA 
0   NM_136609.3  CG8073-RA, transcript variant A (Pmm45A), mRNA 
0   16  NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   14  NM_001014623.1  CG33555-RD, transcript variant D (btsz), mRNA 
0   NM_139482.1  CG14950-RA (CG14950), mRNA 
0   11  NM_078797.2  CG13109-RA (tai), mRNA 
0   NM_135859.1  CG17341-RA (CG17341), mRNA 
0   NM_130546.2  CG11409-RB (CG11409), mRNA 
0   NM_140919.1  CG7385-RA (CG7385), mRNA 
0   NM_132544.1  CG18130-RA (CG18130), mRNA 
0   NM_058023.4  CG4900-RA (Irp-1A), mRNA 
0   NM_144447.1  CG18870-RA (CG18870), mRNA 
0   12  NM_078740.2  CG8817-RB, transcript variant B (lilli), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.