National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4244R-1 
 Symbol Su(dx)  Full Name Suppressor of deltex 
 CG No CG4244  Old CG No CG4244 
 Synonyms Su(deltex), Su(Dx), CG4244, anon-WO0073329.4, anon-WO0073329.2, anon-WO0073329.1, Su(dx) 
 Accession No (Link to NCBI) NM_164448.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Huang S, Zhang Z, Zhang C, Lv X, Zheng X, Chen Z, Sun L, Wang H, Zhu Y, Zhang J, Yang S, Lu Y, Sun Q, Tao Y, Liu F, Zhao Y, Chen D.
Activation of Smurf E3 ligase promoted by smoothened regulates hedgehog signaling through targeting patched turnover.
PLoS Biol. (2013) 11(11) e1001721 [ PubMed ID = 24302888 ] [ RRC reference ]

Casso DJ, Biehs B, Kornberg TB.
A novel interaction between hedgehog and Notch promotes proliferation at the anterior-posterior organizer of the Drosophila wing.
Genetics (2011) 187(2) 485-99 [ PubMed ID = 21098717 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGTGGGAGTGCCAATCAAG 
 Primer Seq. 3'
aatctagaggtaccACTGACCACCGACGGATTGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGTGGGAG TGCCAATCAA GGATATCATC AATTAAGCGT GACAATCGAG GAGGCTTCGC 
0061 TGCGCAACAA TGGCTTCCTC AAGCCAAATC CCTACGTGGA GCTCTTGATT GACAGCAAAA 
0121 GCAAGCGGAA AACGGACCTG GTGAAGAACA GCTATTTGCC CAAGTGGAAC GAGGAGTTTC 
0181 ACAGTGCTGA TTACACCCAA TTCAACGCTG CACTTCAAAG TGCTGGATCA CTCCAGTTTC 
0241 CGTAAAGATG CCATGCTTGG AGAGCGGATC ATCAACCTGG CGCACATTCT GCAGCACTAC 
0301 AATGGGCGGT GCGAGTTCCT TGAGCTGACC ATCGACCTGT TCGTCACCAG CAAGTCGGAC 
0361 AATCGCCAGA CGAAGAGCGG CGAACTAGTg GCCATCCTCA ATGGCCTCAA ACTCGATATG 
0421 AGCAAGCTGC AGATTCAgCC AGTGGCTGGC CAACAGAATG GCAATCCAcC CGTCCAGGCG 
0481 GTCAATCCGT CGGTGGTCAG T 
 in silico PCR Fragment
0001 CCAGTGGGAG TGCCAATCAA GGATATCATC AATTAAGCGT GACAATCGAG GAGGCTTCGC 
0061 TGCGCAACAA TGGCTTCCTC AAGCCAAATC CCTACGTGGA GCTCTTGATT GACAGCAAAA 
0121 GCAAGCGGAA AACGGACCTG GTGAAGAACA GCTATTTGCC CAAGTGGAAC GAGGAG-TTC 
0181 ACAGTGCTGA TTACACCCAA TTCAACGCTG CACTTCAAAG TGCTGGATCA CTCCAGTTTC 
0241 CGTAAAGATG CCATGCTTGG AGAGCGGATC ATCAACCTGG CGCACATTCT GCAGCACTAC 
0301 AATGGGCGGT GCGAGTTCCT TGAGCTGACC ATCGACCTGT TCGTCACCAG CAAGTCGGAC 
0361 AATCGCCAGA CGAAGAGCGG CGAACTAGTG GCCATCCTCA ATGGCCTCAA ACTCGATATG 
0421 AGCAAGCTGC AGATTCAGCC AGTGGCTGGC CAACAGAATG GCAATCCACC CGTCCAGGCG 
0481 GTCAATCCGT CGGTGGTCAG T 
 Assemble Data

4244R-1.IR_full       1   CCAGTGGGAGTGCCAATCAAGGATATCATCAATTAAGCGTGACAATCGAGGAGGCTTCGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4244R-1.in silico     1   CCAGTGGGAGTGCCAATCAAGGATATCATCAATTAAGCGTGACAATCGAGGAGGCTTCGC 60


4244R-1.IR_full       61  TGCGCAACAATGGCTTCCTCAAGCCAAATCCCTACGTGGAGCTCTTGATTGACAGCAAAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4244R-1.in silico     61  TGCGCAACAATGGCTTCCTCAAGCCAAATCCCTACGTGGAGCTCTTGATTGACAGCAAAA 120


4244R-1.IR_full       121 GCAAGCGGAAAACGGACCTGGTGAAGAACAGCTATTTGCCCAAGTGGAACGAGGAGTTTC 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
4244R-1.in silico     121 GCAAGCGGAAAACGGACCTGGTGAAGAACAGCTATTTGCCCAAGTGGAACGAGGAG-TTC 180


4244R-1.IR_full       181 ACAGTGCTGATTACACCCAATTCAACGCTGCACTTCAAAGTGCTGGATCACTCCAGTTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4244R-1.in silico     181 ACAGTGCTGATTACACCCAATTCAACGCTGCACTTCAAAGTGCTGGATCACTCCAGTTTC 240


4244R-1.IR_full       241 CGTAAAGATGCCATGCTTGGAGAGCGGATCATCAACCTGGCGCACATTCTGCAGCACTAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4244R-1.in silico     241 CGTAAAGATGCCATGCTTGGAGAGCGGATCATCAACCTGGCGCACATTCTGCAGCACTAC 300


4244R-1.IR_full       301 AATGGGCGGTGCGAGTTCCTTGAGCTGACCATCGACCTGTTCGTCACCAGCAAGTCGGAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4244R-1.in silico     301 AATGGGCGGTGCGAGTTCCTTGAGCTGACCATCGACCTGTTCGTCACCAGCAAGTCGGAC 360


4244R-1.IR_full       361 AATCGCCAGACGAAGAGCGGCGAACTAGTGGCCATCCTCAATGGCCTCAAACTCGATATG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4244R-1.in silico     361 AATCGCCAGACGAAGAGCGGCGAACTAGTGGCCATCCTCAATGGCCTCAAACTCGATATG 420


4244R-1.IR_full       421 AGCAAGCTGCAGATTCAGCCAGTGGCTGGCCAACAGAATGGCAATCCACCCGTCCAGGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4244R-1.in silico     421 AGCAAGCTGCAGATTCAGCCAGTGGCTGGCCAACAGAATGGCAATCCACCCGTCCAGGCG 480


4244R-1.IR_full       481 GTCAATCCGTCGGTGGTCAGT 501
                          |||||||||||||||||||||
4244R-1.in silico     481 GTCAATCCGTCGGTGGTCAGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164448.1  CG4244-RA, transcript variant A (Su(dx)), mRNA 
100   482  NM_057405.2  CG4244-RB, transcript variant B (Su(dx)), mRNA 
100   482  NM_164449.1  CG4244-RC, transcript variant C (Su(dx)), mRNA 
0.82   NM_136060.1  CG10348-RA (CG10348), mRNA 
0   NM_139839.3  CG32381-RA (unc-13-4A), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_135554.2  CG5300-RA (Klp31E), mRNA 
0   NM_206418.2  CG14575-RB (capaR), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_170642.1  CG32464-RI, transcript variant I (l(3)82Fd), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_134904.2  CG3523-RA (CG3523), mRNA 
0   NM_136583.2  CG8232-RA (CG8232), mRNA 
0   NM_168389.1  CG6707-RB, transcript variant B (CG6707), mRNA 
0   NM_206777.1  CG5659-RC, transcript variant C (ari-1), mRNA 
0   NM_167610.3  CG5659-RB, transcript variant B (ari-1), mRNA 
0   NM_078675.3  CG5659-RA, transcript variant A (ari-1), mRNA 
0   NM_168388.1  CG6707-RC, transcript variant C (CG6707), mRNA 
0   NM_140115.1  CG6707-RA, transcript variant A (CG6707), mRNA 
0   NM_138090.1  CG12252-RA (CG12252), mRNA 
0   NM_135971.1  CG13283-RA (CG13283), mRNA 
0   NM_079513.2  CG1088-RB, transcript variant B (Vha26), mRNA 
0   NM_169073.1  CG1088-RA, transcript variant A (Vha26), mRNA 
0   NM_140130.1  CG8065-RA (CG8065), mRNA 
0   NM_079619.2  CG9829-RA (poly), mRNA 
0   NM_166671.1  CG30164-RA (CG30164), mRNA 
0   NM_130684.1  CG3598-RA (CG3598), mRNA 
0   NM_143034.3  CG5808-RA (CG5808), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.