National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4184R-3 
 Symbol MED15  Full Name Mediator complex subunit 15 
 CG No CG4184  Old CG No CG4184 
 Synonyms Arc105, Med9/ARC105, dARC105, CG4184, BcDNA:GH03922, MED15 
 Accession No (Link to NCBI) NM_134684.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jia D, Soylemez M, Calvin G, Bornmann R, Bryant J, Hanna C, Huang YC, Deng WM.
A large-scale in vivo RNAi screen to identify genes involved in Notch-mediated follicle cell differentiation and cell cycle switches.
Sci Rep (2015) 5 12328 [ PubMed ID = 26205122 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACCGAGGACTGGCAGAGT 
 Primer Seq. 3'
aatctagaggtaccACCTGCATCATCTGCTGGGCA 
 Predicted Fragment Size
521 
 IR fragment full Seq
0001 ATGACCGAGG ACTGGCAGAG TCAAAAGTTT CGTCAGAATG TCATCTCCAA AATCCACGAC 
0061 TTATTGCCAC CGAATGCGCA GGACCAGACT AAAAATGCCG GCGTTATGGA GAACCCACAT 
0121 ATTTAGAAAG TCGCGTACTA AGGACGAGTA TTTAGGTCTG GTAGCCAAGC TCTTTATGCA 
0181 TTACAAAGAC ATGTCACGAA AGTCCCAGCA ACAGCAGCAG CAGCAACAAC AGCAGGGTGG 
0241 CCCGCCCCCA AATGCGGAAA TGGGCGGCGG GCAGAATATG ATGCAGGATC CACTGAACGC 
0301 ACTTCAGAAT CTTGCCAGTC AAGGAAATCG CAATCCCCAG ATGATGCCCA TGGGCGCCGG 
0361 AGGAGGAGCG CCAGTGCCCG GTGGCCCCGG AACTGCCTCT AACTTGCTAC AATCCCCTGA 
0421 ATCAGCAGCG CCCTGGACAG CAGCAAAATG CAGCCCAATG TCAAAATATC CGTGGCCAAA 
0481 TGGCCCATGG GGTGCCGGAG GNGCTNGGGT GCCCAGCAGA TGATGCAGGT  
 in silico PCR Fragment
0001 ATGACCGAGG ACTGGCAGAG TCAAAAGTTT CGTCAGAATG TCATCTCCAA AATCCACGAC 
0061 TTATTGCCAC CGAATGCGCA GGACCAGACT AAAAATGCCG GCGTTATGGA GAA-CCACAT 
0121 ATTTCGAAAG TCGCGTACTA AGGACGAGTA TTTAGGTCTG GTAGCCAAGC TCTTTATGCA 
0181 TTACAAAGAC ATGTCACGAA AGTCCCAGCA ACAGCAGCAG CAGCAACAAC AGCAGGGTGG 
0241 CCCGCCCCCA AATGCGGAAA TGGGCGGCGG GCAGAATATG ATGCAGGATC CACTGAACGC 
0301 ACTTCAGAAT CTTGCCAGTC AAGGAAATCG CAATCCCCAG ATGATGCCCA TGGGCGCCGG 
0361 AGGAGGAGCG CCAGTGCCCG GTGGCCCCGG AACTGCCTCT AACTTGCTAC AAT-CCCTGA 
0421 ATCAGCAGCG CCCTGGACAG CAGC-AAATG CAGCCC-ATG TC-AAATATC CGTGGCCAAA 
0481 T-GCCCAT-G GGTGCCGGAG GAGCT--GGT GCCCAGCAGA TGATGCAGGT  
 Assemble Data

4184R-3.IR_full       1   ATGACCGAGGACTGGCAGAGTCAAAAGTTTCGTCAGAATGTCATCTCCAAAATCCACGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4184R-3.in silico     1   ATGACCGAGGACTGGCAGAGTCAAAAGTTTCGTCAGAATGTCATCTCCAAAATCCACGAC 60


4184R-3.IR_full       61  TTATTGCCACCGAATGCGCAGGACCAGACTAAAAATGCCGGCGTTATGGAGAACCCACAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
4184R-3.in silico     61  TTATTGCCACCGAATGCGCAGGACCAGACTAAAAATGCCGGCGTTATGGAGAA-CCACAT 120


4184R-3.IR_full       121 ATTTAGAAAGTCGCGTACTAAGGACGAGTATTTAGGTCTGGTAGCCAAGCTCTTTATGCA 180
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
4184R-3.in silico     121 ATTTCGAAAGTCGCGTACTAAGGACGAGTATTTAGGTCTGGTAGCCAAGCTCTTTATGCA 180


4184R-3.IR_full       181 TTACAAAGACATGTCACGAAAGTCCCAGCAACAGCAGCAGCAGCAACAACAGCAGGGTGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4184R-3.in silico     181 TTACAAAGACATGTCACGAAAGTCCCAGCAACAGCAGCAGCAGCAACAACAGCAGGGTGG 240


4184R-3.IR_full       241 CCCGCCCCCAAATGCGGAAATGGGCGGCGGGCAGAATATGATGCAGGATCCACTGAACGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4184R-3.in silico     241 CCCGCCCCCAAATGCGGAAATGGGCGGCGGGCAGAATATGATGCAGGATCCACTGAACGC 300


4184R-3.IR_full       301 ACTTCAGAATCTTGCCAGTCAAGGAAATCGCAATCCCCAGATGATGCCCATGGGCGCCGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4184R-3.in silico     301 ACTTCAGAATCTTGCCAGTCAAGGAAATCGCAATCCCCAGATGATGCCCATGGGCGCCGG 360


4184R-3.IR_full       361 AGGAGGAGCGCCAGTGCCCGGTGGCCCCGGAACTGCCTCTAACTTGCTACAATCCCCTGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
4184R-3.in silico     361 AGGAGGAGCGCCAGTGCCCGGTGGCCCCGGAACTGCCTCTAACTTGCTACAAT-CCCTGA 420


4184R-3.IR_full       421 ATCAGCAGCGCCCTGGACAGCAGCAAAATGCAGCCCAATGTCAAAATATCCGTGGCCAAA 480
                          |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||
4184R-3.in silico     421 ATCAGCAGCGCCCTGGACAGCAGC-AAATGCAGCCC-ATGTC-AAATATCCGTGGCCAAA 480


4184R-3.IR_full       481 TGGCCCATGGGGTGCCGGAGGNGCTNGGGTGCCCAGCAGATGATGCAGGT 530
                          | |||||| |||||||||||| |||  |||||||||||||||||||||||
4184R-3.in silico     481 T-GCCCAT-GGGTGCCGGAGGAGCT--GGTGCCCAGCAGATGATGCAGGT 530

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   503  15  40  NM_134684.2  CG4184-RA (MED15), mRNA 
11.92   60  360  915  1378  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
11.92   60  360  915  1378  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
11.92   60  360  915  1378  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
6.36   32  49  126  204  NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
5.76   29  123  366  690  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
5.76   29  123  366  690  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
5.76   29  81  152  293  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
5.76   29  81  152  293  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
5.76   29  81  152  293  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
5.56   28  71  171  368  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
5.56   28  71  171  368  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
4.57   23  69  186  308  NM_132246.2  CG10555-RA (CG10555), mRNA 
4.57   23  56  134  202  NM_166992.2  CG2904-RA (ec), mRNA 
4.37   22  107  264  518  NM_135077.2  CG14023-RA (CG14023), mRNA 
4.17   21  58  130  199  NM_132126.1  CG3075-RA (CG3075), mRNA 
4.17   21  45  119  278  NM_001014575.1  CG7391-RE, transcript variant E (Clk), mRNA 
4.17   21  45  119  278  NM_001014574.1  CG7391-RF, transcript variant F (Clk), mRNA 
4.17   21  45  119  278  NM_001014576.1  CG7391-RD, transcript variant D (Clk), mRNA 
4.17   21  45  119  278  NM_079240.2  CG7391-RA, transcript variant A (Clk), mRNA 
4.17   21  45  119  278  NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 
4.17   21  45  119  278  NM_170628.1  CG7391-RB, transcript variant B (Clk), mRNA 
3.97   20  129  290  587  NM_168571.2  CG32133-RA (CG32133), mRNA 
3.77   19  59  138  324  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
3.77   19  59  138  324  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
3.57   18  77  225  461  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
3.57   18  77  225  461  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
3.57   18  59  113  234  NM_132004.2  CG4136-RA (CG4136), mRNA 
3.57   18  43  131  226  NM_206357.2  CG33261-RD, transcript variant D (Trl), mRNA 
3.57   18  40  104  152  NM_206360.1  CG33261-RF, transcript variant F (Trl), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.