National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4166R-1 
 Symbol not  Full Name non-stop 
 CG No CG4166  Old CG No CG4166 
 Synonyms i155, CG4166, l(3)02069, l(3)j9A6, anon-WO0257455.9, not 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Mahesh G, Rivas GBS, Caster C, Ost EB, Amunugama R, Jones R, Allen DL, Hardin PE.
Proteomic analysis of Drosophila CLOCK complexes identifies rhythmic interactions with SAGA and Tip60 complex component NIPPED-A.
Sci Rep (2020) 10(1) 17951 [ PubMed ID = 33087840 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATATGCGCGCGTGTGTATGTGTTTGCGTGCAGTGCGAAATAGAAACAAGAAAAGCAAGCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAAAATCACAGAAATTCACAAAAAAAAAGCCCAACTACTTCCAAAATTGGGCCGCCCGGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAAGAACCGCAAAAGTGGCCAAAATTCGGCGAAAACAGCGCAAGTGTGACAAAGCATTCG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGCCGCTGCAGTCGTCGGCGAAACGGGCGAAAACAAAAGAGAATAGTGTTGATAGTAATA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGAGCGTATTTAGCAGTAGCAGCAGCAGCAGCAGTGGCCGAAGCTTCGGCAGGGGAACGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACGGTGGGCGGTGGGTGCAGAAGCGGGCCGGGGAACGGCCGAGAACGAAACACTAGCAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TAGCAGCAGCAGCAGCGACAACAACAAATGCCGGTCGCTTTATCACCGCCGATCTAATCA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAACAGTTAACAGCGACAAGCAGCGAGACAGAGTAGCAAAGGGCCACAGGGACGCGAAAA 480

4166R-1.IR full       481 ACCCCNTAGATGCCACCAA- 500
                          ||||| ||||||||||||| silico     481 ACCCCCTAGATGCCACCAAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.