National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4166R-1 
 Symbol not  Full Name non-stop 
 CG No CG4166  Old CG No CG4166 
 Synonyms i155, CG4166, l(3)02069, l(3)j9A6, anon-WO0257455.9, not 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mahesh G, Rivas GBS, Caster C, Ost EB, Amunugama R, Jones R, Allen DL, Hardin PE.
Proteomic analysis of Drosophila CLOCK complexes identifies rhythmic interactions with SAGA and Tip60 complex component NIPPED-A.
Sci Rep (2020) 10(1) 17951 [ PubMed ID = 33087840 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATATGCGCGCGTGTGTATGTG 
 Primer Seq. 3'
aatctagaggtaccTTTGGTGGCATCTAGGGGGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATATGCNCGC GTGTGTATGT GTTTGCGTGC AGTGCGAAAT AGAAACAAGA AAAGCAAGCG 
0061 AAAAATCACA GAAATTCACA AAAAAAAAGC CCAACTACTT CCAAAATTGG GCCGCCCGGC 
0121 GAAGAACCGC AAAAGTGGCC AAAATTCGGC GAAAACAGCG CAAGTGTGAC AAAGCATTCG 
0181 TGCCGCTGCA GTCGTCGGCG AAACGGGCGA AAACAAAAGA GAATAGTGTT GATAGTAATA 
0241 CGAGCGTATT TAGCAGTAGC AGCAGCAGCA GCAGTGGCCG AAGCTTCGGC AGGGGAACGG 
0301 AACGGTGGGC GGTGGGTGCA GAAGCGGGCC GGGGAACGGC CGAGAACGAA ACACTAGCAG 
0361 TAGCAGCAGC AGCAGCGACA ACAACAAATG CCGGTCGCTT TATCACCGCC GATCTAATCA 
0421 AAACAGTTAA CAGCGACAAG CAGCGAGACA GAGTAGCAAA GGGCCACAGG GACGCGAAAA 
0481 ACCCCNTAGA TGCCACCAA 
 in silico PCR Fragment
0001 ATATGCGCGC GTGTGTATGT GTTTGCGTGC AGTGCGAAAT AGAAACAAGA AAAGCAAGCG 
0061 AAAAATCACA GAAATTCACA AAAAAAAAGC CCAACTACTT CCAAAATTGG GCCGCCCGGC 
0121 GAAGAACCGC AAAAGTGGCC AAAATTCGGC GAAAACAGCG CAAGTGTGAC AAAGCATTCG 
0181 TGCCGCTGCA GTCGTCGGCG AAACGGGCGA AAACAAAAGA GAATAGTGTT GATAGTAATA 
0241 CGAGCGTATT TAGCAGTAGC AGCAGCAGCA GCAGTGGCCG AAGCTTCGGC AGGGGAACGG 
0301 AACGGTGGGC GGTGGGTGCA GAAGCGGGCC GGGGAACGGC CGAGAACGAA ACACTAGCAG 
0361 TAGCAGCAGC AGCAGCGACA ACAACAAATG CCGGTCGCTT TATCACCGCC GATCTAATCA 
0421 AAACAGTTAA CAGCGACAAG CAGCGAGACA GAGTAGCAAA GGGCCACAGG GACGCGAAAA 
0481 ACCCCCTAGA TGCCACCAAA  
 Assemble Data

4166R-1.IR full       1   ATATGCNCGCGTGTGTATGTGTTTGCGTGCAGTGCGAAATAGAAACAAGAAAAGCAAGCG 60
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
4166R-1.in silico     1   ATATGCGCGCGTGTGTATGTGTTTGCGTGCAGTGCGAAATAGAAACAAGAAAAGCAAGCG 60


4166R-1.IR full       61  AAAAATCACAGAAATTCACAAAAAAAAAGCCCAACTACTTCCAAAATTGGGCCGCCCGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4166R-1.in silico     61  AAAAATCACAGAAATTCACAAAAAAAAAGCCCAACTACTTCCAAAATTGGGCCGCCCGGC 120


4166R-1.IR full       121 GAAGAACCGCAAAAGTGGCCAAAATTCGGCGAAAACAGCGCAAGTGTGACAAAGCATTCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4166R-1.in silico     121 GAAGAACCGCAAAAGTGGCCAAAATTCGGCGAAAACAGCGCAAGTGTGACAAAGCATTCG 180


4166R-1.IR full       181 TGCCGCTGCAGTCGTCGGCGAAACGGGCGAAAACAAAAGAGAATAGTGTTGATAGTAATA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4166R-1.in silico     181 TGCCGCTGCAGTCGTCGGCGAAACGGGCGAAAACAAAAGAGAATAGTGTTGATAGTAATA 240


4166R-1.IR full       241 CGAGCGTATTTAGCAGTAGCAGCAGCAGCAGCAGTGGCCGAAGCTTCGGCAGGGGAACGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4166R-1.in silico     241 CGAGCGTATTTAGCAGTAGCAGCAGCAGCAGCAGTGGCCGAAGCTTCGGCAGGGGAACGG 300


4166R-1.IR full       301 AACGGTGGGCGGTGGGTGCAGAAGCGGGCCGGGGAACGGCCGAGAACGAAACACTAGCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4166R-1.in silico     301 AACGGTGGGCGGTGGGTGCAGAAGCGGGCCGGGGAACGGCCGAGAACGAAACACTAGCAG 360


4166R-1.IR full       361 TAGCAGCAGCAGCAGCGACAACAACAAATGCCGGTCGCTTTATCACCGCCGATCTAATCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4166R-1.in silico     361 TAGCAGCAGCAGCAGCGACAACAACAAATGCCGGTCGCTTTATCACCGCCGATCTAATCA 420


4166R-1.IR full       421 AAACAGTTAACAGCGACAAGCAGCGAGACAGAGTAGCAAAGGGCCACAGGGACGCGAAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4166R-1.in silico     421 AAACAGTTAACAGCGACAAGCAGCGAGACAGAGTAGCAAAGGGCCACAGGGACGCGAAAA 480


4166R-1.IR full       481 ACCCCNTAGATGCCACCAA- 500
                          ||||| ||||||||||||| 
4166R-1.in silico     481 ACCCCCTAGATGCCACCAAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.