National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4164R-4 
 Symbol CG4164  Full Name CG4164 
 CG No CG4164  Old CG No CG4164 
 Synonyms CG4164 
 Accession No (Link to NCBI) NM_134681.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGAAGAAGGCGTATCGCCGT 
 Primer Seq. 3'
aatctagaggtaccAATGTGCGCTCCTCGTTGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGAAGAAGG CGTATCGCCG TTTGGCCAAG GAGCTGCATC CGGATAAGAA CAAGGACGAC 
0061 CCGGATGCCT CTCACAAAGT TCCAGGACCT GGGAGCGGCC TACGAAGTCC TCTCCAATCC 
0121 GGACAAACGG AAGACCTACG ACCGCTGCGG CGAGGNAATG CCTCAAGAAG GAGGGCATGA 
0181 TGGATCACGG TGGTGATCCG TTCTCTAGCT TCTTTGGGGA CTTCGGCTTT CACTTCGGTG 
0241 GTGATGGCCA GCAGCAANGN TGCTNCgCGA GGCGCCGATA TCGTAATGGA CTTGTACGTT 
0301 TCCCTGGAGG AGCTATACTC CGGAAACTTT GTGGAAATTG TGAGGAACAA GCCTGTAACG 
0361 AAACCCgNCT CAGGCACCAG GAAATGCAAC TGCCGCCAGG AGATGGTCAC CCGGAACCTT 
0421 GGACCCGGGC GCTTCCAGAT GATCCAACAG ACGGTGTGCG ACGAGTGTCC CAACGTGAAG 
0481 CTAGTCAACG AGGAGCGCAC ATT 
 in silico PCR Fragment
0001 GTGAAGAAGG CGTATCGCCG TTTGGCCAAG GAGCTGCATC CGGATAAGAA CAAGGACGAC 
0061 CCGGATGCCT C-CACAAAGT TCCAGGACCT GGGAGCGGCC TACGAAGTCC TCTCCAATCC 
0121 GGACAAACGG AAGACCTACG ACCGCTGCGG CGAGG-AATG CCTCAAGAAG GAGGGCATGA 
0181 TGGATCACGG TGGTGATCCG TTCTCTAGCT TCTTTGGGGA CTTCGGCTTT CACTTCGGTG 
0241 GTGATGGCCA GCAGCAA-GA TGCTCCGCGA GGCGCCGATA TCGTAATGGA CTTGTACGTT 
0301 TCCCTGGAGG AGCTATACTC CGGAAACTTT GTGGAAATTG TGAGGAACAA GCCTGTAACG 
0361 AAACCCGCCT CAGGCACCAG GAAATGCAAC TGCCGCCAGG AGATGGTCAC CCGGAACCTT 
0421 GGACCCGGGC GCTTCCAGAT GATCCAACAG ACGGTGTGCG ACGAGTGTCC CAACGTGAAG 
0481 CTAGTCAACG AGGAGCGCAC ATT 
 Assemble Data

4164R-4.IR_full        1   TGAAGAAGGCGTATCGCCGTTTGGCCAAGGAGCTGCATCCGGATAAGAACAAGGACGAC 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4164R-4.in silico      1   TGAAGAAGGCGTATCGCCGTTTGGCCAAGGAGCTGCATCCGGATAAGAACAAGGACGAC 59


4164R-4.IR_full       61  CCGGATGCCTCTCACAAAGTTCCAGGACCTGGGAGCGGCCTACGAAGTCCTCTCCAATCC 119
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
4164R-4.in silico     61  CCGGATGCCTC-CACAAAGTTCCAGGACCTGGGAGCGGCCTACGAAGTCCTCTCCAATCC 119


4164R-4.IR_full       121 GGACAAACGGAAGACCTACGACCGCTGCGGCGAGGNAATGCCTCAAGAAGGAGGGCATGA 179
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
4164R-4.in silico     121 GGACAAACGGAAGACCTACGACCGCTGCGGCGAGG-AATGCCTCAAGAAGGAGGGCATGA 179


4164R-4.IR_full       181 TGGATCACGGTGGTGATCCGTTCTCTAGCTTCTTTGGGGACTTCGGCTTTCACTTCGGTG 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4164R-4.in silico     181 TGGATCACGGTGGTGATCCGTTCTCTAGCTTCTTTGGGGACTTCGGCTTTCACTTCGGTG 239


4164R-4.IR_full       241 GTGATGGCCAGCAGCAANGNTGCTNCGCGAGGCGCCGATATCGTAATGGACTTGTACGTT 299
                          ||||||||||||||||| | |||| |||||||||||||||||||||||||||||||||||
4164R-4.in silico     241 GTGATGGCCAGCAGCAA-GATGCTCCGCGAGGCGCCGATATCGTAATGGACTTGTACGTT 299


4164R-4.IR_full       301 TCCCTGGAGGAGCTATACTCCGGAAACTTTGTGGAAATTGTGAGGAACAAGCCTGTAACG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4164R-4.in silico     301 TCCCTGGAGGAGCTATACTCCGGAAACTTTGTGGAAATTGTGAGGAACAAGCCTGTAACG 359


4164R-4.IR_full       361 AAACCCGNCTCAGGCACCAGGAAATGCAACTGCCGCCAGGAGATGGTCACCCGGAACCTT 419
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
4164R-4.in silico     361 AAACCCGCCTCAGGCACCAGGAAATGCAACTGCCGCCAGGAGATGGTCACCCGGAACCTT 419


4164R-4.IR_full       421 GGACCCGGGCGCTTCCAGATGATCCAACAGACGGTGTGCGACGAGTGTCCCAACGTGAAG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4164R-4.in silico     421 GGACCCGGGCGCTTCCAGATGATCCAACAGACGGTGTGCGACGAGTGTCCCAACGTGAAG 479


4164R-4.IR_full       481 CTAGTCAACGAGGAGCGCACATT 502
                          |||||||||||||||||||||||
4164R-4.in silico     481 CTAGTCAACGAGGAGCGCACATT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134681.2  CG4164-RA (CG4164), mRNA 
0   NM_140053.2  CG3967-RC, transcript variant C (CG3967), mRNA 
0   NM_170630.1  CG3967-RD, transcript variant D (CG3967), mRNA 
0   NM_170631.1  CG3967-RE, transcript variant E (CG3967), mRNA 
0   NM_140052.1  CG3967-RA, transcript variant A (CG3967), mRNA 
0   NM_167884.1  CG1009-RE, transcript variant E (Psa), mRNA 
0   NM_167883.1  CG1009-RC, transcript variant C (Psa), mRNA 
0   NM_167887.1  CG1009-RF, transcript variant F (Psa), mRNA 
0   NM_167885.1  CG1009-RA, transcript variant A (Psa), mRNA 
0   NM_139360.2  CG1009-RB, transcript variant B (Psa), mRNA 
0   NM_167886.1  CG1009-RD, transcript variant D (Psa), mRNA 
0   NM_080215.2  CG18525-RA, transcript variant A (Spn5), mRNA 
0   NM_176501.1  CG18525-RB, transcript variant B (Spn5), mRNA 
0   NM_135267.1  CG5155-RA (CG5155), mRNA 
0   NM_080041.2  CG7935-RA (msk), mRNA 
0   NM_134669.2  CG11601-RA (CG11601), mRNA 
0   NM_078905.2  CG12847-RA (Tsp42Ec), mRNA 
0   NM_167344.1  CG32644-RB (CG32644), mRNA 
0   NM_080333.2  CG3346-RA (pon), mRNA 
0   NM_142474.1  CG14304-RA (CG14304), mRNA 
0   NM_136993.2  CG3955-RA (CG3955), mRNA 
0   NM_137991.1  CG4763-RA (CG4763), mRNA 
0   NM_165490.1  CG3427-RA (Epac), mRNA 
0   10  NM_206209.1  CG5504-RC, transcript variant C (l(2)tid), mRNA 
0   10  NM_080193.3  CG5504-RA, transcript variant A (l(2)tid), mRNA 
0   10  NM_206210.1  CG5504-RB, transcript variant B (l(2)tid), mRNA 
0   NM_138142.3  CG2790-RA (CG2790), mRNA 
0   NM_176212.1  CG33197-RA, transcript variant A (mbl), mRNA 
0   NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
0   NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
++ 
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.