National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4155R-2 
 Symbol Brf  Full Name Brf 
 CG No CG31256  Old CG No CG4155 
 Synonyms TFIIIB, BRF, BRF1, CG5419, CG4155, CG31256, Brf 
 Accession No (Link to NCBI) NM_142359.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Marshall L, Rideout EJ, Grewal SS.
Nutrient/TOR-dependent regulation of RNA polymerase III controls tissue and organismal growth in Drosophila.
EMBO J. (2012) 31(8) 1916-30 [ PubMed ID = 22367393 ] [ RRC reference ]

Sriskanthadevan-Pirahas S, Deshpande R, Lee B, Grewal SS.
Ras/ERK-signalling promotes tRNA synthesis and growth via the RNA polymerase III repressor Maf1 in Drosophila.
PLoS Genet. (2018) 14(2) e1007202 [ PubMed ID = 29401457 ] [ RRC reference ]

Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCAACCGACTGCAGTTGGG 
 Primer Seq. 3'
aatctagaggtaccTGCTATTGGGCGTGCTTGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCCAACCGA CTGCAGTTGG GTGCCAAAAC GCACGAGGTT TCGATGACGG CTCTGAGGAT 
0061 TGTCCAGCGC ATGAAAAAGG ACTGCATGCA CTCGGGACGA CGACCCACTG GCCTTTGTGG 
0121 AGCAGCTTTG CTGATTGCGG CCCGGATGCA CGATTTTAGT CGCACCATGC TGGACGTGAT 
0181 AGGTGTGGTC AACGATACAC GAGTCAACGC TCCGAAAGCG TCTTTCGGAG TTTGCTGAAA 
0241 CGCCCTCGGG AGGGCTAACC CTGGAGGAGT TCATGACCGT TGACTTGGAG CGCGAACAGG 
0301 ATCCGCCTTC CTTTATAGGC AGCACCGGCA AAAAGGATCG TGAGAGCAAT CAAAGATATG 
0361 GGCGAGCATG AGCTAACAGA ATTGCAAAAA GAAATTGATG CTCATCTGGA AAAAGATCTA 
0421 GGCAAGTACT CaAACTCCGT TTACCGTCAG CTGACTAAGG GTAAGGGATT AAGTCCACTG 
0481 AGCTCTCCAA GCACGCCCAA TAGCA 
 in silico PCR Fragment
0001 TGCCAACCGA CTGCAGTTGG GTGCCAAAAC GCACGAGGTT TCGATGACGG CTCTGAGGAT 
0061 TGTCCAGCGC ATGAAAAAGG ACTGCATGCA CTCGGGACGA CGACCCACTG GCCTTTGTGG 
0121 AGCAGCTTTG CTGATTGCGG CCCGGATGCA CGATTTTAGT CGCACCATGC TGGACGTGAT 
0181 AGGTGTGGTC AA-GATACAC GAGTCAACGC TCCGAAAGCG TCTTTCGGAG TTTGCTGAAA 
0241 CGCCCTCGGG AGGGCTAACC CTGGAGGAGT TCATGACCGT TGACTTGGAG CGCGAACAGG 
0301 ATCCGCCTTC CTTTA-AGGC AGCAC--GCA AAAAGGATCG TGAGAG-AAT CAAAGATATG 
0361 GGCGAGCATG AGCTAACAGA ATTGCAAAAA GAAATTGATG CTCATCTGGA AAAAGATCTA 
0421 GGCAAGTACT CAAACTCCGT TTACCGTCAG CTGACTAAGG GTAAGGGATT AAGTCCACTG 
0481 AGCTCTCCAA GCACGCCCAA TAGCA 
 Assemble Data

4155R-2.IR_full       1   TGCCAACCGACTGCAGTTGGGTGCCAAAACGCACGAGGTTTCGATGACGGCTCTGAGGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4155R-2.in silico     1   TGCCAACCGACTGCAGTTGGGTGCCAAAACGCACGAGGTTTCGATGACGGCTCTGAGGAT 60


4155R-2.IR_full       61  TGTCCAGCGCATGAAAAAGGACTGCATGCACTCGGGACGACGACCCACTGGCCTTTGTGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4155R-2.in silico     61  TGTCCAGCGCATGAAAAAGGACTGCATGCACTCGGGACGACGACCCACTGGCCTTTGTGG 120


4155R-2.IR_full       121 AGCAGCTTTGCTGATTGCGGCCCGGATGCACGATTTTAGTCGCACCATGCTGGACGTGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4155R-2.in silico     121 AGCAGCTTTGCTGATTGCGGCCCGGATGCACGATTTTAGTCGCACCATGCTGGACGTGAT 180


4155R-2.IR_full       181 AGGTGTGGTCAACGATACACGAGTCAACGCTCCGAAAGCGTCTTTCGGAGTTTGCTGAAA 240
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
4155R-2.in silico     181 AGGTGTGGTCAA-GATACACGAGTCAACGCTCCGAAAGCGTCTTTCGGAGTTTGCTGAAA 240


4155R-2.IR_full       241 CGCCCTCGGGAGGGCTAACCCTGGAGGAGTTCATGACCGTTGACTTGGAGCGCGAACAGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4155R-2.in silico     241 CGCCCTCGGGAGGGCTAACCCTGGAGGAGTTCATGACCGTTGACTTGGAGCGCGAACAGG 300


4155R-2.IR_full       301 ATCCGCCTTCCTTTATAGGCAGCACCGGCAAAAAGGATCGTGAGAGCAATCAAAGATATG 360
                          ||||||||||||||| |||||||||  ||||||||||||||||||| |||||||||||||
4155R-2.in silico     301 ATCCGCCTTCCTTTA-AGGCAGCAC--GCAAAAAGGATCGTGAGAG-AATCAAAGATATG 360


4155R-2.IR_full       361 GGCGAGCATGAGCTAACAGAATTGCAAAAAGAAATTGATGCTCATCTGGAAAAAGATCTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4155R-2.in silico     361 GGCGAGCATGAGCTAACAGAATTGCAAAAAGAAATTGATGCTCATCTGGAAAAAGATCTA 420


4155R-2.IR_full       421 GGCAAGTACTCAAACTCCGTTTACCGTCAGCTGACTAAGGGTAAGGGATTAAGTCCACTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4155R-2.in silico     421 GGCAAGTACTCAAACTCCGTTTACCGTCAGCTGACTAAGGGTAAGGGATTAAGTCCACTG 480


4155R-2.IR_full       481 AGCTCTCCAAGCACGCCCAATAGCA 505
                          |||||||||||||||||||||||||
4155R-2.in silico     481 AGCTCTCCAAGCACGCCCAATAGCA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_142359.2  CG31256-RA (Brf), mRNA 
0   NM_135360.3  CG7830-RA (CG7830), mRNA 
0   NM_164683.1  CG31641-RB, transcript variant B (stai), mRNA 
0   NM_164682.1  CG31641-RC, transcript variant C (stai), mRNA 
0   NM_057784.4  CG7833-RA (Orc5), mRNA 
0   NM_176177.1  CG33139-RA (Ranbp11), mRNA 
0   34  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_139990.2  CG5971-RA (CG5971), mRNA 
0   NM_131921.1  CG15375-RA (CG15375), mRNA 
0   NM_136455.1  CG2093-RA (CG2093), mRNA 
0   NM_001038780.1  CG33979-RA, transcript variant A (capt), mRNA 
0   NM_001038781.1  CG33979-RB, transcript variant B (capt), mRNA 
0   NM_139443.1  CG13809-RA (osm-1), mRNA 
0   NM_079232.1  CG14827-RA (mei-P22), mRNA 
0   NM_168471.1  CG11652-RB, transcript variant B (CG11652), mRNA 
0   NM_080018.1  CG6890-RA (Tollo), mRNA 
0   NM_078507.2  CG3926-RA (Spat), mRNA 
0   NM_164549.1  CG31778-RA (CG31778), mRNA 
0   NM_134654.1  CG4648-RA (CG4648), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_169502.1  CG8774-RB, transcript variant B (CG8774), mRNA 
0   NM_142017.2  CG8774-RA, transcript variant A (CG8774), mRNA 
0   NM_057548.3  CG10385-RA (msl-1), mRNA 
0   NM_001032402.1  CG33957-RB, transcript variant B (cp309), mRNA 
0   NM_168258.1  CG7404-RA, transcript variant A (ERR), mRNA 
0   NM_139926.1  CG7404-RB, transcript variant B (ERR), mRNA 
0   NM_139460.1  CG9004-RA (CG9004), mRNA 
0   NM_001014694.1  CG1464-RC, transcript variant C (ey), mRNA 
0   NM_079889.2  CG1464-RA, transcript variant A (ey), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.