National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4155R-1 
 Symbol Brf  Full Name Brf 
 CG No CG31256  Old CG No CG4155 
 Synonyms TFIIIB, BRF, BRF1, CG5419, CG4155, CG31256, Brf 
 Accession No (Link to NCBI) NM_142359.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Sriskanthadevan-Pirahas S, Deshpande R, Lee B, Grewal SS.
Ras/ERK-signalling promotes tRNA synthesis and growth via the RNA polymerase III repressor Maf1 in Drosophila.
PLoS Genet (2018) 14(2) e1007202 [ PubMed ID = 29401457 ] [ RRC reference ]

Marshall L, Rideout EJ, Grewal SS.
Nutrient/TOR-dependent regulation of RNA polymerase III controls tissue and organismal growth in Drosophila.
EMBO J (2012) 31(8) 1916-30 [ PubMed ID = 22367393 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J Cell Biol (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc Natl Acad Sci U S A (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCCAACCGACTGCAGTTGGGTGCCAAAACGCACGAGGTTTCGATGACGGCTCTGAGGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGTCCAGCGCATGAAAAAGGACTGCATGCACTCGGGACGACGACCCACTGGCCTTTGTGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCAGCTTTGCTGATTGCGGCCCGGATGCACGATTTTAGTCGCACCATGCTGGACGTGAT 180

                          |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGTGTGGTCAA-GATACACGAGTCAACGCTCCGAAAGCGTCTTTCGGAGTTTGCTGAAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCCCTCGGGAGGGCTAACCCTGGAGGAGTTCATGACCGTTGACTTGGAGCGCGAACAGG 300

                          ||||||||||||||| |||||||||  ||||||||||||||||||| ||||||||||||| silico     301 ATCCGCCTTCCTTTA-AGGCAGCAC--GCAAAAAGGATCGTGAGAG-AATCAAAGATATG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCGAGCATGAGCTAACAGAATTGCAAAAAGAAATTGATGCTCATCTGGAAAAAGATCTA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCAAGTACTCAAACTCCGTTTACCGTCAGCTGACTAAGGGTAAGGGATTAAGTCCACTG 480

                          ||||||||||||||||||||||||| silico     481 AGCTCTCCAAGCACGCCCAATAGCA 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_142359.2  CG31256-RA (Brf), mRNA 
0   NM_135360.3  CG7830-RA (CG7830), mRNA 
0   NM_164683.1  CG31641-RB, transcript variant B (stai), mRNA 
0   NM_164682.1  CG31641-RC, transcript variant C (stai), mRNA 
0   NM_057784.4  CG7833-RA (Orc5), mRNA 
0   NM_176177.1  CG33139-RA (Ranbp11), mRNA 
0   34  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_139990.2  CG5971-RA (CG5971), mRNA 
0   NM_131921.1  CG15375-RA (CG15375), mRNA 
0   NM_136455.1  CG2093-RA (CG2093), mRNA 
0   NM_001038780.1  CG33979-RA, transcript variant A (capt), mRNA 
0   NM_001038781.1  CG33979-RB, transcript variant B (capt), mRNA 
0   NM_139443.1  CG13809-RA (osm-1), mRNA 
0   NM_079232.1  CG14827-RA (mei-P22), mRNA 
0   NM_168471.1  CG11652-RB, transcript variant B (CG11652), mRNA 
0   NM_080018.1  CG6890-RA (Tollo), mRNA 
0   NM_078507.2  CG3926-RA (Spat), mRNA 
0   NM_164549.1  CG31778-RA (CG31778), mRNA 
0   NM_134654.1  CG4648-RA (CG4648), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_169502.1  CG8774-RB, transcript variant B (CG8774), mRNA 
0   NM_142017.2  CG8774-RA, transcript variant A (CG8774), mRNA 
0   NM_057548.3  CG10385-RA (msl-1), mRNA 
0   NM_001032402.1  CG33957-RB, transcript variant B (cp309), mRNA 
0   NM_168258.1  CG7404-RA, transcript variant A (ERR), mRNA 
0   NM_139926.1  CG7404-RB, transcript variant B (ERR), mRNA 
0   NM_139460.1  CG9004-RA (CG9004), mRNA 
0   NM_001014694.1  CG1464-RC, transcript variant C (ey), mRNA 
0   NM_079889.2  CG1464-RA, transcript variant A (ey), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.