National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4107R-1 
 Symbol Pcaf  Full Name Pcaf 
 CG No CG4107  Old CG No CG4107 
 Synonyms dGcn5, dmGCN5, GCN5, PCAF, Gcn5, P/CAF, dmHAG401, gcn5, CG4107, dGCN5, Gcn5/PCAF, dGCN5 HAT, p/CAF, dPCAF, anon-WO0172774.89, Pcaf, Gcn5/Pcaf 
 Accession No (Link to NCBI) NM_140329.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ma Y, Chen Z, Jin Y, Liu W.
Identification of a histone acetyltransferase as a novel regulator of Drosophila intestinal stem cells.
FEBS Lett (2013) 587(10) 1489-95 [ PubMed ID = 23535028 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGCAGCGAATGGCGCAGCAA 
 Primer Seq. 3'
aatctagaggtaccGCACTGGCGCAGCAAACGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGCAGCGAA TGGCGCAGCA ACCGCTGGTG CATCTGGAGC CGCTgGCAGC GcCCAGAATC 
0061 CAGGACACGG AGGAGCTGCG TCCGGCGCTG GCAGTGTGCc gGCAGAGGGA ACGCGCCAGA 
0121 ACAGCCTCAC AGCGCATTCA GCAGCGAAAA GCAAAAGGTC TTCAATCTGC CCGTGCCACA 
0181 GAAACTGGCC AAATTGTCGA TGTATTCCGC CTGCCAGTCT GAGGGGATGC CGTTGCACCG 
0241 GCTGGAAGAC ACCGCAGGAA AATCGCCACC GTGACGTCGA GTCCTCCTAC TGTCCGGAGT 
0301 TCAACGAGGA GTGCCGCAAC ACCAGCTGTC GCCATTCGCT GAGATCGCAC ATAGCCCATC 
0361 TGGACAATAT ATCCAGTTCC AGCATGAACG AGCTACTGGG CGCCATTATA GACATGGAGA 
0421 ACCTATTCAT GTCCATGCAG CGCGTCGAGG ACGAGGACAC CAAGAAGGTG TACCAGTACC 
0481 TCTTCCGTTT gcTGCGCCAG TCGGC 
 in silico PCR Fragment
0001 AGGCAGCGAA TGGCGCAGCA ACCGCTGGTG CATCTGGAGC CGCTGGCAGC GCCCAGAATC 
0061 CAGGACACGG AGGAGCTGCG TCCGGCGCTG GCAGTGTGCC GGCAGAGGGA ACGCGCCAGA 
0121 ACAGCCT-AC AGCGCATTCA GCAGCGAAA- GCAAAAGGTC TTCAATCTGC CCGTGCCACA 
0181 GAAACTGGCC AAATTGTCGA TGTATTCCGC CTGCCAGTCT GA-GGGATGC CGTTGCACCG 
0241 GCTGGAAGAC ACCGCAGGAA AATCGCCACC GTGACGTCGA GTCCTCCTAC TGTCCGGAGT 
0301 TCAACGAGGA GTGCCGCAAC ACCAGCTGTC GCCATTCGCT GAGATCGCAC ATAGCCCATC 
0361 TGGACAATAT ATCCAGTTCC AGCATGAACG AGCTACTGGG CGCCATTATA GACATGGAGA 
0421 ACCTATTCAT GTCCATGCAG CGCGTCGAGG ACGAGGACAC CAAGAAGGTG TACCAGTACC 
0481 TCTTCCGTTT GCTGCGCCAG T--GC 
 Assemble Data

4107R-1.IR_full       1   AGGCAGCGAATGGCGCAGCAACCGCTGGTGCATCTGGAGCCGCTGGCAGCGCCCAGAATC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4107R-1.in silico     1   AGGCAGCGAATGGCGCAGCAACCGCTGGTGCATCTGGAGCCGCTGGCAGCGCCCAGAATC 60


4107R-1.IR_full       61  CAGGACACGGAGGAGCTGCGTCCGGCGCTGGCAGTGTGCCGGCAGAGGGAACGCGCCAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4107R-1.in silico     61  CAGGACACGGAGGAGCTGCGTCCGGCGCTGGCAGTGTGCCGGCAGAGGGAACGCGCCAGA 120


4107R-1.IR_full       121 ACAGCCTCACAGCGCATTCAGCAGCGAAAAGCAAAAGGTCTTCAATCTGCCCGTGCCACA 180
                          ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||
4107R-1.in silico     121 ACAGCCT-ACAGCGCATTCAGCAGCGAAA-GCAAAAGGTCTTCAATCTGCCCGTGCCACA 180


4107R-1.IR_full       181 GAAACTGGCCAAATTGTCGATGTATTCCGCCTGCCAGTCTGAGGGGATGCCGTTGCACCG 240
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
4107R-1.in silico     181 GAAACTGGCCAAATTGTCGATGTATTCCGCCTGCCAGTCTGA-GGGATGCCGTTGCACCG 240


4107R-1.IR_full       241 GCTGGAAGACACCGCAGGAAAATCGCCACCGTGACGTCGAGTCCTCCTACTGTCCGGAGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4107R-1.in silico     241 GCTGGAAGACACCGCAGGAAAATCGCCACCGTGACGTCGAGTCCTCCTACTGTCCGGAGT 300


4107R-1.IR_full       301 TCAACGAGGAGTGCCGCAACACCAGCTGTCGCCATTCGCTGAGATCGCACATAGCCCATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4107R-1.in silico     301 TCAACGAGGAGTGCCGCAACACCAGCTGTCGCCATTCGCTGAGATCGCACATAGCCCATC 360


4107R-1.IR_full       361 TGGACAATATATCCAGTTCCAGCATGAACGAGCTACTGGGCGCCATTATAGACATGGAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4107R-1.in silico     361 TGGACAATATATCCAGTTCCAGCATGAACGAGCTACTGGGCGCCATTATAGACATGGAGA 420


4107R-1.IR_full       421 ACCTATTCATGTCCATGCAGCGCGTCGAGGACGAGGACACCAAGAAGGTGTACCAGTACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4107R-1.in silico     421 ACCTATTCATGTCCATGCAGCGCGTCGAGGACGAGGACACCAAGAAGGTGTACCAGTACC 480


4107R-1.IR_full       481 TCTTCCGTTTGCTGCGCCAGTCGGC 505
                          |||||||||||||||||||||  ||
4107R-1.in silico     481 TCTTCCGTTTGCTGCGCCAGT--GC 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140329.2  CG4107-RA (Pcaf), mRNA 
0.2   NM_166516.1  CG11170-RB (CG11170), mRNA 
0   12  NM_176723.2  CG33175-RG, transcript variant G (spri), mRNA 
0   NM_001032403.1  CG7649-RB, transcript variant B (Neu3), mRNA 
0   NM_001032404.1  CG7649-RA, transcript variant A (Neu3), mRNA 
0   NM_136080.1  CG10431-RA (CG10431), mRNA 
0   NM_139598.2  CG14989-RB (CG14989), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_168934.1  CG11248-RB, transcript variant B (CG11248), mRNA 
0   NM_141091.1  CG11248-RA, transcript variant A (CG11248), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_137183.1  CG8102-RB, transcript variant B (CG8102), mRNA 
0   NM_168301.1  CG5735-RD, transcript variant D (orb2), mRNA 
0   NM_140009.1  CG5735-RB, transcript variant B (orb2), mRNA 
0   NM_168300.1  CG5735-RC, transcript variant C (orb2), mRNA 
0   NM_168302.1  CG5735-RA, transcript variant A (orb2), mRNA 
0   NM_166086.1  CG8102-RA, transcript variant A (CG8102), mRNA 
0   NM_137081.2  CG30483-RA (Prosap), mRNA 
0   NM_140816.1  CG6841-RA (CG6841), mRNA 
0   NM_140116.2  CG8104-RA (nudE), mRNA 
0   NM_140264.1  CG5897-RA (CG5897), mRNA 
0   NM_143386.2  CG14528-RA (CG14528), mRNA 
0   NM_206586.1  CG31038-RC, transcript variant C (CG31038), mRNA 
0   NM_142558.2  CG7342-RA (CG7342), mRNA 
0   NM_137703.1  CG15655-RA (CG15655), mRNA 
0   NM_080132.2  CG11295-RA (l(2)dtl), mRNA 
0   NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_136035.4  CG10283-RA, transcript variant A (CG10283), mRNA 
0   NM_165255.1  CG10283-RB, transcript variant B (CG10283), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.