National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4104R-6 
 Symbol Tps1  Full Name Trehalose-6-phosphate synthase 1 
 CG No CG4104  Old CG No CG4104 
 Synonyms tps1, TreS, CG4104, dtps1, TPS, jf5, BcDNA:GH08860, l(2)k08903, l(2)jf5, l(2)jf4, l(2)24Ea, Tps1 
 Accession No (Link to NCBI) NM_134983.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Matsuda H, Yamada T, Yoshida M, Nishimura T.
Flies without trehalose.
J Biol Chem. (2015) 290(2) 1244-55 [ PubMed ID = 25451929 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCCGACACGGAAATCATC 
 Primer Seq. 3'
aatctagaggtaccTCTCGCTGCCCTGGTTTTTGG 
 Predicted Fragment Size
502 
 IR fragment full Seq
0001 NTGCCCGACA CGGTAAATCA TCGTTACCCA ATGNCCGGGG AGCCCTCCAC CAAGGCGATG 
0061 TCTCATCGTG GTATCCAATC GGTTGCCGTT TGTGCTTATC CGAGATCCGA AGACCGATGA 
0121 GTTGGAACGC ANGGGCCAGT GCCGGTGGCC TGGTGACTGC AGTGTGCCCG GTGGTGATCA 
0181 AGGGCAGTGG TCTCTGGGTG GGCTGGTCGG GTATCCACTT GAAGGATCCT AACGAGGCCA 
0241 TTCCCGAGTC CAATCCCAAC GATCAGACTC CGACTGCTGG CCTCAAGTCC GAGCAGGTGG 
0301 TGTCCGTCAA CATCGATTCG AAGATCTTCG ATAGCTACTA CAACGGATGC TGCAACAAGA 
0361 TCTTCTGGCC ACTGTTCCAC TCGATGCCGG GAAGAGCCAA CTTCGGAGGC GAGCACTGGC 
0421 ACGACTATGT CACTGTCAAC AAGCACTTCG CCGTGCGGAC CATCGAGGCT CTGGAGAAGT 
0481 GCCTGGCCAA AAACCAGGGC AGCGAGA 
 in silico PCR Fragment
0001 ATGCCCGACA CGG-AAATCA TCGTTA-CCA ATG-CCGGGG AGCCCTCCAC CAAGGCGA-G 
0061 TCTCATCGTG GTATCCAATC GGTTGCCGTT TGTGCTTATC CGAGATCCGA AGACCGATGA 
0121 GTTGGAACGC A-GGGCCAGT GCCGGTGGCC TGGTGACTGC AGTGTGCCCG GTGGTGATCA 
0181 AGGGCAGTGG TCTCTGGGTG GGCTGGTCGG GTATCCACTT GAAGGATCCT AACGAGGCCA 
0241 TTCCCGAGTC CAATCCCAAC GATCAGACTC CGACTGCTGG CCTCAAGTCC GAGCAGGTGG 
0301 TGTCCGTCAA CATCGATTCG AAGATCTTCG ATAGCTACTA CAACGGATGC TGCAACAAGA 
0361 TCTTCTGGCC ACTGTTCCAC TCGATGCCGG GAAGAGCCAA CTTCGGAGGC GAGCACTGGC 
0421 ACGACTATGT CACTGTCAAC AAGCACTTCG CCGTGCGGAC CATCGAGGCT CTGGAGAAGT 
0481 GCCTGGCCAA AAACCAGGGC AGCGAGA 
 Assemble Data

4104R-6.IR_full        1   TGCCCGACACGGTAAATCATCGTTACCCAATGNCCGGGGAGCCCTCCACCAAGGCGATG 59
                           |||||||||||| |||||||||||| |||||| |||||||||||||||||||||||| |
4104R-6.in silico      1   TGCCCGACACGG-AAATCATCGTTA-CCAATG-CCGGGGAGCCCTCCACCAAGGCGA-G 59


4104R-6.IR_full       61  TCTCATCGTGGTATCCAATCGGTTGCCGTTTGTGCTTATCCGAGATCCGAAGACCGATGA 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4104R-6.in silico     61  TCTCATCGTGGTATCCAATCGGTTGCCGTTTGTGCTTATCCGAGATCCGAAGACCGATGA 119


4104R-6.IR_full       121 GTTGGAACGCANGGGCCAGTGCCGGTGGCCTGGTGACTGCAGTGTGCCCGGTGGTGATCA 179
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
4104R-6.in silico     121 GTTGGAACGCA-GGGCCAGTGCCGGTGGCCTGGTGACTGCAGTGTGCCCGGTGGTGATCA 179


4104R-6.IR_full       181 AGGGCAGTGGTCTCTGGGTGGGCTGGTCGGGTATCCACTTGAAGGATCCTAACGAGGCCA 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4104R-6.in silico     181 AGGGCAGTGGTCTCTGGGTGGGCTGGTCGGGTATCCACTTGAAGGATCCTAACGAGGCCA 239


4104R-6.IR_full       241 TTCCCGAGTCCAATCCCAACGATCAGACTCCGACTGCTGGCCTCAAGTCCGAGCAGGTGG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4104R-6.in silico     241 TTCCCGAGTCCAATCCCAACGATCAGACTCCGACTGCTGGCCTCAAGTCCGAGCAGGTGG 299


4104R-6.IR_full       301 TGTCCGTCAACATCGATTCGAAGATCTTCGATAGCTACTACAACGGATGCTGCAACAAGA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4104R-6.in silico     301 TGTCCGTCAACATCGATTCGAAGATCTTCGATAGCTACTACAACGGATGCTGCAACAAGA 359


4104R-6.IR_full       361 TCTTCTGGCCACTGTTCCACTCGATGCCGGGAAGAGCCAACTTCGGAGGCGAGCACTGGC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4104R-6.in silico     361 TCTTCTGGCCACTGTTCCACTCGATGCCGGGAAGAGCCAACTTCGGAGGCGAGCACTGGC 419


4104R-6.IR_full       421 ACGACTATGTCACTGTCAACAAGCACTTCGCCGTGCGGACCATCGAGGCTCTGGAGAAGT 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4104R-6.in silico     421 ACGACTATGTCACTGTCAACAAGCACTTCGCCGTGCGGACCATCGAGGCTCTGGAGAAGT 479


4104R-6.IR_full       481 GCCTGGCCAAAAACCAGGGCAGCGAGA 506
                          |||||||||||||||||||||||||||
4104R-6.in silico     481 GCCTGGCCAAAAACCAGGGCAGCGAGA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   484  NM_134983.2  CG4104-RA (Tps1), mRNA 
0.2   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_169225.1  CG31259-RA (CG31259), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_169191.2  CG31146-RD (CG31146), mRNA 
0   NM_079108.2  CG30170-RA (bgcn), mRNA 
0   NM_143618.2  CG1774-RA (CG1774), mRNA 
0   NM_134734.2  CG5080-RB, transcript variant B (CG5080), mRNA 
0   NM_164406.1  CG5080-RA, transcript variant A (CG5080), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_134936.2  CG8843-RA (sec5), mRNA 
0   NM_206494.1  CG4898-RL, transcript variant L (Tm1), mRNA 
0   NM_079636.2  CG4898-RA, transcript variant A (Tm1), mRNA 
0   NM_142600.2  CG4433-RA, transcript variant A (CG4433), mRNA 
0   NM_206519.1  CG4433-RB, transcript variant B (CG4433), mRNA 
0   NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_001014461.1  CG9967-RB, transcript variant B (CG9967), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 
0   NM_140442.1  CG7906-RA (CG7906), mRNA 
0   NM_132304.2  CG9060-RA (Zpr1), mRNA 
0   NM_135131.1  CG13992-RA (CG13992), mRNA 
0   NM_165616.1  CG30354-RA (CG30354), mRNA 
0   NM_142665.1  CG15697-RA, transcript variant A (RpS30), mRNA 
0   NM_169933.1  CG15697-RB, transcript variant B (RpS30), mRNA 
0   NM_137616.2  CG11208-RA (CG11208), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.