National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4082R-2 
 Symbol Mcm5  Full Name Minichromosome maintenance 5 
 CG No CG4082  Old CG No CG4082 
 Synonyms MCM5, mcm5, CG4082, DmMcm5, DmMCM5, PCR4, DmCDC465, DmCDC46, Mcm5, McM5 
 Accession No (Link to NCBI) NM_079584.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Park SY, Asano M.
The origin recognition complex is dispensable for endoreplication in Drosophila.
Proc. Natl. Acad. Sci. U.S.A. (2008) 105(34) 12343-8 [ PubMed ID = 18711130 ] [ RRC reference ]

Kohzaki H.
The function of replication and SCF complex during Drosophila wing development.
Front Biosci (Landmark Ed) (2018) 23 2235-2244 [ PubMed ID = 29772558 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCGACGATGCGGGTGTGTTC 
 Primer Seq. 3'
aatctagaggtaccCAGGACAGGCATTGGATAGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCGACGATG CGGGTGTGTT CTTTATCGGA CTAATTTGCG CGGCGGAGTA TAACCAGCAG 
0061 GATGCGCTAA AATCAACTTG CAGGCGGTAA AGAAGAAGTA CAAGGAGTTC ATCCGGACAT 
0121 TTAACGAGGA GAACTTTTTC TACAAATACC GTGACACNCC TGAAGAGGAA CTATCTTAAT 
0181 GGTCGCTACT TCTTGGAGAT TGAGATGGAG GATTTGGTGG GCTTCGATGA GACCTTGGCT 
0241 GACAAGCTGA ACAAGCAGCC GACGGAGCAT TTGGAAATCT TCGAGGAGGC TGCCCGGGAG 
0301 GTAGCCGACG AGATCACAGC TCCCCGGCCG GAGCACGAGG AACATATGCA CGACATCCAG 
0361 ATTCTTCTGA GCTCCAATGC GAATCCCACC AACATACGAC AGTTGAAGTC GGaCTGCGTA 
0421 TCCAAGCTGG TTAAGATCGC CGGAATCATT GTCGCAGCCT CAGGAATAAG TGCCAAggNT 
0481 ACGCGGATGT CTATCCAATG CCTGTCCTG 
 in silico PCR Fragment
0001 TTCGACGATG CGGGTGTGTT CTTT-TCGGA C-AATTT--- CGGCGGAG-A TAACCAGCAG 
0061 GATGCGC--A AATCAACTTG CAGGCGGTAA AGAAGAAGTA CAAGGAGTTC ATCCGGACAT 
0121 TTAACGAGGA GAACTTTTTC TACAAATACC GTGACAC-CC TGAAGAGGAA CTATCTTAAT 
0181 GGTCGCTACT TCTTGGAGAT TGAGATGGAG GATTTGGTGG GCTTCGATGA GACCTTGGCT 
0241 GACAAGCTGA ACAAGCAGCC GACGGAGCAT TTGGAAATCT TCGAGGAGGC TGCCCGGGAG 
0301 GTAGCCGACG AGATCACAGC TCCCCGGCCG GAGCACGAGG AACATATGCA CGACATCCAG 
0361 ATTCTTCTGA GCTCCAATGC GAATCCCACC AACATACGAC AGTTGAAGTC GGACTGCGTA 
0421 TCCAAGCTGG TTAAGATCGC CGGAATCATT GTCGCAGCCT CAGGAATAAG TGCCAAGGCT 
0481 ACGCGGATGT CTATCCAATG CCTGTCCTG 
 Assemble Data

4082R-2.IR_full       1   TTCGACGATGCGGGTGTGTTCTTTATCGGACTAATTTGCGCGGCGGAGTATAACCAGCAG 60
                          |||||||||||||||||||||||| |||||| |||||   |||||||| |||||||||||
4082R-2.in silico     1   TTCGACGATGCGGGTGTGTTCTTT-TCGGAC-AATTT---CGGCGGAG-ATAACCAGCAG 60


4082R-2.IR_full       61  GATGCGCTAAAATCAACTTGCAGGCGGTAAAGAAGAAGTACAAGGAGTTCATCCGGACAT 120
                          |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||
4082R-2.in silico     61  GATGCGC--AAATCAACTTGCAGGCGGTAAAGAAGAAGTACAAGGAGTTCATCCGGACAT 120


4082R-2.IR_full       121 TTAACGAGGAGAACTTTTTCTACAAATACCGTGACACNCCTGAAGAGGAACTATCTTAAT 180
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
4082R-2.in silico     121 TTAACGAGGAGAACTTTTTCTACAAATACCGTGACAC-CCTGAAGAGGAACTATCTTAAT 180


4082R-2.IR_full       181 GGTCGCTACTTCTTGGAGATTGAGATGGAGGATTTGGTGGGCTTCGATGAGACCTTGGCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4082R-2.in silico     181 GGTCGCTACTTCTTGGAGATTGAGATGGAGGATTTGGTGGGCTTCGATGAGACCTTGGCT 240


4082R-2.IR_full       241 GACAAGCTGAACAAGCAGCCGACGGAGCATTTGGAAATCTTCGAGGAGGCTGCCCGGGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4082R-2.in silico     241 GACAAGCTGAACAAGCAGCCGACGGAGCATTTGGAAATCTTCGAGGAGGCTGCCCGGGAG 300


4082R-2.IR_full       301 GTAGCCGACGAGATCACAGCTCCCCGGCCGGAGCACGAGGAACATATGCACGACATCCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4082R-2.in silico     301 GTAGCCGACGAGATCACAGCTCCCCGGCCGGAGCACGAGGAACATATGCACGACATCCAG 360


4082R-2.IR_full       361 ATTCTTCTGAGCTCCAATGCGAATCCCACCAACATACGACAGTTGAAGTCGGACTGCGTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4082R-2.in silico     361 ATTCTTCTGAGCTCCAATGCGAATCCCACCAACATACGACAGTTGAAGTCGGACTGCGTA 420


4082R-2.IR_full       421 TCCAAGCTGGTTAAGATCGCCGGAATCATTGTCGCAGCCTCAGGAATAAGTGCCAAGGNT 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
4082R-2.in silico     421 TCCAAGCTGGTTAAGATCGCCGGAATCATTGTCGCAGCCTCAGGAATAAGTGCCAAGGCT 480


4082R-2.IR_full       481 ACGCGGATGTCTATCCAATGCCTGTCCTG 509
                          |||||||||||||||||||||||||||||
4082R-2.in silico     481 ACGCGGATGTCTATCCAATGCCTGTCCTG 509

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079584.2  CG4082-RA (Mcm5), mRNA 
0.2   NM_134895.2  CG3605-RA (CG3605), mRNA 
0   NM_079874.2  CG2098-RA, transcript variant A (ferrochelatase), mRNA 
0   NM_170580.2  CG2098-RB, transcript variant B (ferrochelatase), mRNA 
0   NM_170579.2  CG2098-RC, transcript variant C (ferrochelatase), mRNA 
0   NM_170437.1  CG31032-RA (CG31032), mRNA 
0   NM_141262.2  CG12005-RB (Mms19), mRNA 
0   NM_142240.1  CG14876-RA (CG14876), mRNA 
0   NM_142587.1  CG4755-RA (RhoGAP92B), mRNA 
0   NM_143021.2  CG5796-RA (Ppox), mRNA 
0   NM_166909.2  CG14814-RA, transcript variant A (CG14814), mRNA 
0   NM_130591.2  CG14814-RB, transcript variant B (CG14814), mRNA 
0   NM_078687.1  CG12529-RA, transcript variant A (Zw), mRNA 
0   NM_167676.1  CG12529-RB, transcript variant B (Zw), mRNA 
0   NM_135935.2  CG12455-RA, transcript variant A (CG12455), mRNA 
0   NM_165149.1  CG12455-RB, transcript variant B (CG12455), mRNA 
0   NM_176716.2  CG7766-RB, transcript variant B (CG7766), mRNA 
0   NM_132297.4  CG7766-RA, transcript variant A (CG7766), mRNA 
0   NM_134646.2  CG11377-RA (CG11377), mRNA 
0   NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_078544.2  CG1689-RA (lz), mRNA 
0   NM_080046.2  CG10986-RB (g), mRNA 
0   NM_142558.2  CG7342-RA (CG7342), mRNA 
0   NM_130547.3  CG11412-RC, transcript variant C (CG11412), mRNA 
0   NM_166878.1  CG11412-RA, transcript variant A (CG11412), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_137691.2  CG9346-RA (CG9346), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.