National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4073R-3 
 Symbol CG4073  Full Name CG4073 
 CG No CG4073  Old CG No CG4073 
 Synonyms CG4073 
 Accession No (Link to NCBI) NM_141753.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Fan W, Lam SM, Xin J, Yang X, Liu Z, Liu Y, Wang Y, Shui G, Huang X.
Drosophila TRF2 and TAF9 regulate lipid droplet size and phospholipid fatty acid composition.
PLoS Genet (2017) 13(3) e1006664 [ PubMed ID = 28273089 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCAAATCCCACGCCACGTTC 
 Primer Seq. 3'
aatctagaggtaccCACCAGTCATCCAGAGCATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCAAATCCC ACGCCACGTT CATCGACGGG TCTACGCAAA CCGACTGGTC AAAGATCAAC 
0061 ACCTCCACCC AGGCCACCAC CTCATGTTCC CGCTCCTGCT CCACCACCGC ATGAGCCTGC 
0121 GATAACCATA TGGAGAATCC CCGGGCCTGC TGAGCCCGGT CGCATCGTCG GGTCCTTTGC 
0181 GCCAACGCTC TTCTGTGCAC CTGAGGAAGA AACACCTCGG TTGGGTCTAC TTGATCCACG 
0241 CGGTTCTATC GGCAAGTGCA GTAATTCAGC TTGTGGTCCT GCGGCTCTGC AATAAGGACT 
0301 TCGGGGAGCT AATTAGCCCA TCGGTGCCCA GCTTCGTGTG GCTGCTCCTG GCCGTGGGAT 
0361 GTGTGCTGAT CATGGCCTAC GTGTACCTGG CCAACCAGTG TCCGTGCAAT GGTCTGCTGG 
0421 CCATTGTCAT CGTGGAGGTG ATAGTGATAT TTGTGAATTG CCACCGGTGG GCTCGTCTAT 
0481 CGATGCTCTG GATGACTGGT G 
 in silico PCR Fragment
0001 GCCAAATCCC ACGCCACGTT CATCGACGGG TCTACGCAAA CCGACTGGTC AAAGATCAAC 
0061 ACCTCCACCC AGGCCACCAC CTCATGTTCC CGCTCCTGCT CCACCACCGC ATGAGCCTGC 
0121 GA-AACCATA TGGAGAATCC CCGGGCCTGC TGAGCCCGGT CGCATCGTCG GGTCCTTTGC 
0181 GCCAACGCTC TTCTGTGCAC CTGAGGAAGA AACACCTCGG TTGGGTCTAC TTGATCCACG 
0241 CGGTTCTATC GGCAAGTGCA GTAATTCAGC TTGTGGTCCT GCGGCTCTGC AATAAGGACT 
0301 TCGGGGAGCT AATTAGCCCA TCGGTGCCCA GCTTCGTGTG GCTGCTCCTG GCCGTGGGAT 
0361 GTGTGCTGAT CATGGCCTAC GTGTACCTGG CCAACCAGTG TCCGTGCAAT GGTCTGCTGG 
0421 CCATTGTCAT CGTGGAGGTG ATAGTGATAT TTGTGAATTG CCACCGGTGG GCTCGTCTAT 
0481 CGATGCTCTG GATGACTGGT G 
 Assemble Data

4073R-3.IR_full       1   GCCAAATCCCACGCCACGTTCATCGACGGGTCTACGCAAACCGACTGGTCAAAGATCAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4073R-3.in silico     1   GCCAAATCCCACGCCACGTTCATCGACGGGTCTACGCAAACCGACTGGTCAAAGATCAAC 60


4073R-3.IR_full       61  ACCTCCACCCAGGCCACCACCTCATGTTCCCGCTCCTGCTCCACCACCGCATGAGCCTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4073R-3.in silico     61  ACCTCCACCCAGGCCACCACCTCATGTTCCCGCTCCTGCTCCACCACCGCATGAGCCTGC 120


4073R-3.IR_full       121 GATAACCATATGGAGAATCCCCGGGCCTGCTGAGCCCGGTCGCATCGTCGGGTCCTTTGC 180
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4073R-3.in silico     121 GA-AACCATATGGAGAATCCCCGGGCCTGCTGAGCCCGGTCGCATCGTCGGGTCCTTTGC 180


4073R-3.IR_full       181 GCCAACGCTCTTCTGTGCACCTGAGGAAGAAACACCTCGGTTGGGTCTACTTGATCCACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4073R-3.in silico     181 GCCAACGCTCTTCTGTGCACCTGAGGAAGAAACACCTCGGTTGGGTCTACTTGATCCACG 240


4073R-3.IR_full       241 CGGTTCTATCGGCAAGTGCAGTAATTCAGCTTGTGGTCCTGCGGCTCTGCAATAAGGACT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4073R-3.in silico     241 CGGTTCTATCGGCAAGTGCAGTAATTCAGCTTGTGGTCCTGCGGCTCTGCAATAAGGACT 300


4073R-3.IR_full       301 TCGGGGAGCTAATTAGCCCATCGGTGCCCAGCTTCGTGTGGCTGCTCCTGGCCGTGGGAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4073R-3.in silico     301 TCGGGGAGCTAATTAGCCCATCGGTGCCCAGCTTCGTGTGGCTGCTCCTGGCCGTGGGAT 360


4073R-3.IR_full       361 GTGTGCTGATCATGGCCTACGTGTACCTGGCCAACCAGTGTCCGTGCAATGGTCTGCTGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4073R-3.in silico     361 GTGTGCTGATCATGGCCTACGTGTACCTGGCCAACCAGTGTCCGTGCAATGGTCTGCTGG 420


4073R-3.IR_full       421 CCATTGTCATCGTGGAGGTGATAGTGATATTTGTGAATTGCCACCGGTGGGCTCGTCTAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4073R-3.in silico     421 CCATTGTCATCGTGGAGGTGATAGTGATATTTGTGAATTGCCACCGGTGGGCTCGTCTAT 480


4073R-3.IR_full       481 CGATGCTCTGGATGACTGGTG 501
                          |||||||||||||||||||||
4073R-3.in silico     481 CGATGCTCTGGATGACTGGTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141753.2  CG4073-RA (CG4073), mRNA 
0   NM_167230.1  CG32683-RA (CG32683), mRNA 
0   NM_138197.2  CG12031-RA, transcript variant A (MED14), mRNA 
0   NM_167835.1  CG12031-RB, transcript variant B (MED14), mRNA 
0   NM_001043234.1  CG12946-RB, transcript variant B (CG12946), mRNA 
0   NM_141687.1  CG12946-RA, transcript variant A (CG12946), mRNA 
0   NM_057459.3  CG12749-RA, transcript variant A (Hrb87F), mRNA 
0   NM_167844.1  CG32479-RA (CG32479), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   10  NM_167218.1  CG32685-RC (CG32685), mRNA 
0   NM_133138.1  CG7884-RA (CG7884), mRNA 
0   NM_167222.1  CG32688-RB, transcript variant B (Hk), mRNA 
0   NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   NM_078575.2  CG9355-RA (dy), mRNA 
0   NM_136583.2  CG8232-RA (CG8232), mRNA 
0   NM_142116.1  CG14852-RA (CG14852), mRNA 
0   NM_136046.2  CG15161-RA (CG15161), mRNA 
0   NM_079618.2  CG8599-RA (Su(var)3-7), mRNA 
0   NM_135093.2  CG14015-RA (CG14015), mRNA 
0   NM_079003.2  CG4604-RA (GLaz), mRNA 
0   NM_135359.2  CG7840-RA (CG7840), mRNA 
0   NM_136616.3  CG8057-RA, transcript variant A (CG8057), mRNA 
0   NM_135905.2  CG15260-RA (CG15260), mRNA 
0   NM_140112.1  CG14165-RA (CG14165), mRNA 
0   NM_142556.2  CG6240-RA (CG6240), mRNA 
0   NM_001032002.1  CG33676-RA, transcript variant A (Skeletor), mRNA 
0   NM_001032000.1  CG14681-RB, transcript variant B (CG14681), mRNA 
0   17  NM_001038758.1  CG9908-RB, transcript variant B (disco), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.