National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4032R-2 
 Symbol Abl  Full Name Abl tyrosine kinase 
 CG No CG4032  Old CG No CG4032 
 Synonyms D-abl, abl, Ableson, AblK, CG4032, DROTKABL3, ABL, Ddash/abl, DAbl, c-abl, 4674, Dash, Am ABL, Dabl, l(3)04674, cAbl, D-ash, l(3)c-abl, l(3)73Ba, abl1, Dsrc7, C-abl, Abl1, Abl, Abl tyrosine kinase, Abl oncogene, Abelson Kinase, Abelson, abelson, D-abelson, abl kinase 
 Accession No (Link to NCBI) NM_080104.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat. Cell Biol. (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATGGCAGTTTCCTGGTCCGT 
 Primer Seq. 3'
aatctagaggtaccGGTGGTTCTCTGGTGCAAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AATGGCAGTT TCCTGGTCCG TGAAAGTGAA AGTTCACCGG GTNCAAAGGA GCATCAGTTT 
0061 GAGATACGAG GGTCGCGTCT ATCACTACCG CATCTCAGAG GATCCCGATG GGAAAGTCTT 
0121 CGTTACCCAG GAGGCCAAGT TTAACACTCT GGCCGAGCTG GTGCATCATC ACAGCGTGCC 
0181 CCATGAGGGT CACGGCCTGA TCACACCGCT CCTATATCCG GCGCCCAAGC AGAACAAGCC 
0241 CACCGTCTTT CCGCTGAGTC CCGAGCCGGA TGAGTGGGAG ATCTGCCGGA CGGACATCAT 
0301 GATGAAGCAC AAGCTAGGCG GCGGTCAGTA CGGAGAGGTC TACGAGGCCG TTTGGAAGCG 
0361 GTATGGCAAT ACGGTGGCTG TTAAAACGCT CAAGGAGGAC ACCATGGCAC TGAAGGACTT 
0421 CCTCGAAGAG GCGGCCATCA TGAAGGAAAT GAAgNACCCT AATCTGGTGC AGCTCATTGG 
0481 TGTTTGCACC AGAGAACCAC C 
 in silico PCR Fragment
0001 AATGGCAGTT TCCTGGTCCG TGAAAGTGAA AGTTCACCGG GT-CAAAGGA GCATCAGTTT 
0061 GAGATACGAG GGTCGCGTCT ATCACTACCG CATCTCAGAG GATCCCGATG GGAAAGTCTT 
0121 CGTTACCCAG GAGGCCAAGT TTAACACTCT GGCCGAGCTG GTGCATCATC ACAGCGTGCC 
0181 CCATGAGGGT CACGGCCTGA TCACACCGCT CCTATATCCG GCGCCCAAGC AGAACAAGCC 
0241 CACCGTCTTT CCGCTGAGTC CCGAGCCGGA TGAGTGGGAG ATCTGCCGGA CGGACATCAT 
0301 GATGAAGCAC AAGCTAGGCG GCGGTCAGTA CGGAGAGGTC TACGAGGCCG TTTGGAAGCG 
0361 GTATGGCAAT ACGGTGGCTG TTAAAACGCT CAAGGAGGAC ACCATGGCAC TGAAGGACTT 
0421 CCTCGAAGAG GCGGCCATCA TGAAGGAAAT GAAGCACCCT AATCTGGTGC AGCTCATTGG 
0481 TGTTTGCACC AGAGAACCAC C 
 Assemble Data

4032R-2.IR_full       1   AATGGCAGTTTCCTGGTCCGTGAAAGTGAAAGTTCACCGGGTNCAAAGGAGCATCAGTTT 60
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
4032R-2.in silico     1   AATGGCAGTTTCCTGGTCCGTGAAAGTGAAAGTTCACCGGGT-CAAAGGAGCATCAGTTT 60


4032R-2.IR_full       61  GAGATACGAGGGTCGCGTCTATCACTACCGCATCTCAGAGGATCCCGATGGGAAAGTCTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4032R-2.in silico     61  GAGATACGAGGGTCGCGTCTATCACTACCGCATCTCAGAGGATCCCGATGGGAAAGTCTT 120


4032R-2.IR_full       121 CGTTACCCAGGAGGCCAAGTTTAACACTCTGGCCGAGCTGGTGCATCATCACAGCGTGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4032R-2.in silico     121 CGTTACCCAGGAGGCCAAGTTTAACACTCTGGCCGAGCTGGTGCATCATCACAGCGTGCC 180


4032R-2.IR_full       181 CCATGAGGGTCACGGCCTGATCACACCGCTCCTATATCCGGCGCCCAAGCAGAACAAGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4032R-2.in silico     181 CCATGAGGGTCACGGCCTGATCACACCGCTCCTATATCCGGCGCCCAAGCAGAACAAGCC 240


4032R-2.IR_full       241 CACCGTCTTTCCGCTGAGTCCCGAGCCGGATGAGTGGGAGATCTGCCGGACGGACATCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4032R-2.in silico     241 CACCGTCTTTCCGCTGAGTCCCGAGCCGGATGAGTGGGAGATCTGCCGGACGGACATCAT 300


4032R-2.IR_full       301 GATGAAGCACAAGCTAGGCGGCGGTCAGTACGGAGAGGTCTACGAGGCCGTTTGGAAGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4032R-2.in silico     301 GATGAAGCACAAGCTAGGCGGCGGTCAGTACGGAGAGGTCTACGAGGCCGTTTGGAAGCG 360


4032R-2.IR_full       361 GTATGGCAATACGGTGGCTGTTAAAACGCTCAAGGAGGACACCATGGCACTGAAGGACTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4032R-2.in silico     361 GTATGGCAATACGGTGGCTGTTAAAACGCTCAAGGAGGACACCATGGCACTGAAGGACTT 420


4032R-2.IR_full       421 CCTCGAAGAGGCGGCCATCATGAAGGAAATGAAGNACCCTAATCTGGTGCAGCTCATTGG 480
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
4032R-2.in silico     421 CCTCGAAGAGGCGGCCATCATGAAGGAAATGAAGCACCCTAATCTGGTGCAGCTCATTGG 480


4032R-2.IR_full       481 TGTTTGCACCAGAGAACCACC 501
                          |||||||||||||||||||||
4032R-2.in silico     481 TGTTTGCACCAGAGAACCACC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080104.2  CG4032-RA (Abl), mRNA 
0   NM_167572.1  CG32555-RA, transcript variant A (RhoGAPp190), mRNA 
0   NM_167573.1  CG32555-RC, transcript variant C (RhoGAPp190), mRNA 
0   NM_133003.2  CG32555-RB, transcript variant B (RhoGAPp190), mRNA 
0   NM_001015081.1  CG40477-PA.3 (CG40477), partial mRNA 
0   NM_001031860.1  CG33653-RA, transcript variant A (Caps), mRNA 
0   NM_001031858.1  CG33653-RC, transcript variant C (Caps), mRNA 
0   NM_001031859.1  CG33653-RB, transcript variant B (Caps), mRNA 
0   NM_132517.1  CG15221-RA (CG15221), mRNA 
0   NM_057374.2  CG3722-RA (shg), mRNA 
0   NM_131932.2  CG2982-RB, transcript variant B (CG2982), mRNA 
0   NM_167007.1  CG2982-RA, transcript variant A (CG2982), mRNA 
0   NM_135945.2  CG5861-RA (CG5861), mRNA 
0   NM_142461.2  CG14309-RA (CG14309), mRNA 
0   NM_130667.2  CG2685-RA (CG2685), mRNA 
0   NM_169023.1  CG31536-RB, transcript variant B (Cdep), mRNA 
0   NM_001043211.1  CG31536-RE, transcript variant E (Cdep), mRNA 
0   NM_169022.1  CG31536-RA, transcript variant A (Cdep), mRNA 
0   NM_140897.2  CG8103-RA, transcript variant A (Mi-2), mRNA 
0   NM_001014591.1  CG8103-RB, transcript variant B (Mi-2), mRNA 
0   NM_139602.2  CG14992-RA (Ack), mRNA 
0   NM_169521.1  CG8863-RD, transcript variant D (CG8863), mRNA 
0   NM_169520.1  CG8863-RC, transcript variant C (CG8863), mRNA 
0   NM_142026.2  CG8863-RA, transcript variant A (CG8863), mRNA 
0   NM_169522.1  CG8863-RE, transcript variant E (CG8863), mRNA 
0   NM_169519.1  CG8863-RB, transcript variant B (CG8863), mRNA 
0   NM_135225.1  CG11323-RA (CG11323), mRNA 
0   NM_136614.4  CG18659-RB, transcript variant B (CG18659), mRNA 
0   NM_145873.2  CG18659-RA, transcript variant A (CG18659), mRNA 
0   NM_140392.1  CG14109-RA (CG14109), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.