National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4019R-2 
 Symbol CG4019  Full Name CG4019 
 CG No CG4019  Old CG No CG4019 
 Synonyms CG4019 
 Accession No (Link to NCBI) NM_137969.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cabrero P, Terhzaz S, Dornan AJ, Ghimire S, Holmes HL, Turin DR, Romero MF, Davies SA, Dow JAT.
Specialized stellate cells offer a privileged route for rapid water flux in Drosophila renal tubule.
Proc. Natl. Acad. Sci. U.S.A. (2020) [ PubMed ID = 31907321 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAAGGGATCGACGCTGGAC 
 Primer Seq. 3'
aatctagaggtaccCCAAATCGAATGCCCACGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGAAGGGAT CGACGCTGGA CAAAATNCTC CGCCTTCCTC GGCGAGCTCA TCGGCACCGG 
0061 CATCCTGGTC TTCCTGGGCT GCATGGGTTG CGTGAAGACG GACCTCTTTC CCAACAACCA 
0121 TCTGCAGATT GTGCTGAACT TCGGCTTCGC CGTCCTCATC GCCATCCAGT GCTTTGGCTG 
0181 CGTCTCCGGT GCCCATCTGA ATCCCGCCGT GACCGTGGCC GCCTACATCT ACGAGATGGT 
0241 CACCCTGCGC ATGGCATTTG CCTACTTCGC CGCCCAGATG CTGGGCGCCT TCATCGGCTA 
0301 CGGCCTGCTC ATGGTCCTGC TTCCCTCGCC CACACTTACG GTGGGCGCTG GGCNTCTGCG 
0361 TGACCTTGCC CCACACCAGC GTAACCACGG GCCAGGCCNT CGGCATCGAG NTTCGTAATC 
0421 ACCTCCATCC TGGTCATCGT CTGCTGCGGA GTGTGGGATC CGCGCAACTC CAAGTTCCAT 
0481 GACTCCGTGG GCATTCGATT TGG 
 in silico PCR Fragment
0001 ATGAAGGGAT CGACGCTGGA CAAAAT-CTC CGCCTTCCTC GGCGAGCTCA TCGGCACCGG 
0061 CATCCTGGTC TTCCTGGGCT GCATGGGTTG CGTGAAGACG GACCTCTTTC CCAACAACCA 
0121 TCTGCAGATT GTGCTGAACT TCGGCTTCGC CGTCCTCATC GCCATCCAGT GCTTTGGCTG 
0181 CGTCTCCGGT GCCCATCTGA ATCCCGCCGT GACCGTGGCC GCCTACATCT ACGAGATGGT 
0241 CACCCTGCGC ATGGCATTTG CCTACTTCGC CGCCCAGATG CTGGGCGCCT TCATCGGCTA 
0301 CGGCCTGCTC ATGGTCCTGC TTCCCTCGCC CACACTTACG GTGGGCGCTG GGC-TCTGCG 
0361 TGACCTTGCC CCACACCAGC GTAACCACGG GCCAGGCCCT CGGCATCGAG -TTCGTAATC 
0421 ACCTCCATCC TGGTCATCGT CTGCTGCGGA GTGTGGGATC CGCGCAACTC CAAGTTCCAT 
0481 GACTCCGTGG GCATTCGATT TGG 
 Assemble Data

4019R-2.IR_full       1   ATGAAGGGATCGACGCTGGACAAAATNCTCCGCCTTCCTCGGCGAGCTCATCGGCACCGG 60
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
4019R-2.in silico     1   ATGAAGGGATCGACGCTGGACAAAAT-CTCCGCCTTCCTCGGCGAGCTCATCGGCACCGG 60


4019R-2.IR_full       61  CATCCTGGTCTTCCTGGGCTGCATGGGTTGCGTGAAGACGGACCTCTTTCCCAACAACCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4019R-2.in silico     61  CATCCTGGTCTTCCTGGGCTGCATGGGTTGCGTGAAGACGGACCTCTTTCCCAACAACCA 120


4019R-2.IR_full       121 TCTGCAGATTGTGCTGAACTTCGGCTTCGCCGTCCTCATCGCCATCCAGTGCTTTGGCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4019R-2.in silico     121 TCTGCAGATTGTGCTGAACTTCGGCTTCGCCGTCCTCATCGCCATCCAGTGCTTTGGCTG 180


4019R-2.IR_full       181 CGTCTCCGGTGCCCATCTGAATCCCGCCGTGACCGTGGCCGCCTACATCTACGAGATGGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4019R-2.in silico     181 CGTCTCCGGTGCCCATCTGAATCCCGCCGTGACCGTGGCCGCCTACATCTACGAGATGGT 240


4019R-2.IR_full       241 CACCCTGCGCATGGCATTTGCCTACTTCGCCGCCCAGATGCTGGGCGCCTTCATCGGCTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4019R-2.in silico     241 CACCCTGCGCATGGCATTTGCCTACTTCGCCGCCCAGATGCTGGGCGCCTTCATCGGCTA 300


4019R-2.IR_full       301 CGGCCTGCTCATGGTCCTGCTTCCCTCGCCCACACTTACGGTGGGCGCTGGGCNTCTGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
4019R-2.in silico     301 CGGCCTGCTCATGGTCCTGCTTCCCTCGCCCACACTTACGGTGGGCGCTGGGC-TCTGCG 360


4019R-2.IR_full       361 TGACCTTGCCCCACACCAGCGTAACCACGGGCCAGGCCNTCGGCATCGAGNTTCGTAATC 420
                          |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
4019R-2.in silico     361 TGACCTTGCCCCACACCAGCGTAACCACGGGCCAGGCCCTCGGCATCGAG-TTCGTAATC 420


4019R-2.IR_full       421 ACCTCCATCCTGGTCATCGTCTGCTGCGGAGTGTGGGATCCGCGCAACTCCAAGTTCCAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4019R-2.in silico     421 ACCTCCATCCTGGTCATCGTCTGCTGCGGAGTGTGGGATCCGCGCAACTCCAAGTTCCAT 480


4019R-2.IR_full       481 GACTCCGTGGGCATTCGATTTGG 503
                          |||||||||||||||||||||||
4019R-2.in silico     481 GACTCCGTGGGCATTCGATTTGG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166615.1  CG4019-RD, transcript variant D (CG4019), mRNA 
100   482  NM_137969.2  CG4019-RA, transcript variant A (CG4019), mRNA 
100   482  NM_166614.1  CG4019-RB, transcript variant B (CG4019), mRNA 
100   482  NM_166613.1  CG4019-RC, transcript variant C (CG4019), mRNA 
0.41   10  24  NM_137968.1  CG17662-RA (CG17662), mRNA 
0   17  27  38  NM_137967.2  CG17664-RA, transcript variant A (CG17664), mRNA 
0   17  27  38  NM_176253.1  CG17664-RB, transcript variant B (CG17664), mRNA 
0   NM_140870.1  CG9300-RA (CG9300), mRNA 
0   17  NM_078712.2  CG12794-RA (lcs), mRNA 
0   NM_078952.2  CG4001-RA, transcript variant A (Pfk), mRNA 
0   NM_165747.2  CG4001-RC, transcript variant C (Pfk), mRNA 
0   NM_165746.1  CG4001-RB, transcript variant B (Pfk), mRNA 
0   NM_164576.2  CG15427-RD, transcript variant D (tutl), mRNA 
0   NM_137884.2  CG13532-RA (CG13532), mRNA 
0   NM_142719.1  CG15497-RA (CG15497), mRNA 
0   NM_143252.2  CG6378-RA (BM-40-SPARC), mRNA 
0   NM_142203.2  CG6136-RA (CG6136), mRNA 
0   NM_057917.3  CG3943-RA (kraken), mRNA 
0   NM_135947.2  CG4455-RA (CG4455), mRNA 
0   NM_132550.2  CG1796-RA (Tango4), mRNA 
0   NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
0   NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
0   NM_169595.1  CG3508-RB, transcript variant B (CG3508), mRNA 
0   NM_142124.2  CG3508-RA, transcript variant A (CG3508), mRNA 
0   NM_166535.1  CG4444-RA (px), mRNA 
0   NM_142581.1  CG4562-RA (CG4562), mRNA 
0   NM_131968.2  CG32772-RA (CG32772), mRNA 
0   NM_080248.1  CG6725-RA (Sulf1), mRNA 
0   NM_079625.2  CG8573-RA, transcript variant A (su(Hw)), mRNA 
0   NM_169574.1  CG8573-RB, transcript variant B (su(Hw)), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
VM
VB
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.