National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3938R-3 
 Symbol CycE  Full Name Cyclin E 
 CG No CG3938  Old CG No CG3938 
 Synonyms CyclE, DmCycE, cycE, cyclinE, DmcycE, Cyc E, D-CycE, fond, BG:DS07108.3, l(2)35Dd, CyeE, l(2)k05007, l(2)k02602, l(2)br37, DmcyclinE, unnamed, l35Dd, br37, CDI7, l(2)k02514, l(2)05206, cdi7, Cdi7, CG3938, CycE, CYCE 
 Accession No (Link to NCBI) NM_057611.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zielke N, Kim KJ, Tran V, Shibutani ST, Bravo MJ, Nagarajan S, van Straaten M, Woods B, von Dassow G, Rottig C, Lehner CF, Grewal SS, Duronio RJ, Edgar BA.
Control of Drosophila endocycles by E2F and CRL4(CDT2).
Nature (2011) 480(7375) 123-7 [ PubMed ID = 22037307 ] [ RRC reference ]

Dui W, Wei B, He F, Lu W, Li C, Liang X, Ma J, Jiao R.
The Drosophila F-box protein dSkp2 regulates cell proliferation by targeting Dacapo for degradation.
Mol. Biol. Cell (2013) 24(11) 1676-87, S1-7 [ PubMed ID = 23552694 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCACTGAGCCAAATGGCAGCA 
 Primer Seq. 3'
aatctagaggtaccCTCGGCCGGTGAGCTACGTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCACTGAGCC AAATGGCAGC ATAGTCACAA CCGCCCCCAG CAACGGAGAA GTGAGCAGCA 
0061 GCATAGTCGT CGTCGTCAGC AGCAGTAGTA TCAGTAGCAG CAGCGNTAgN NCAATCGCTA 
0121 TCCTTCCACA TCCAGATCCA ATCCCATCAA CATCGTTCTC TTCAGCGTCG CAACGAAGTG 
0181 ANAGAGGAGC TACCAGGAAC CTCAGCAGCC TCCAGAACCG ACGAGATGTG CTCTTGTGAT 
0241 AGCCAGAATC TTGCAGCATC CACAGCCGCG ACTTCCAATG GCAATAAACG TAAACGGCGT 
0301 TTAAGCAGCG ATTCAAACGA GGACCCTGAA CTCGGTTTTG AGCCTCCATC AGCTAAGCGC 
0361 NCAGCAGCGA CTGCCCGCTT TGTACGGCAG CGAGCAGGGC AATCTGTCAT CGGTTGCCTC 
0421 CTCGGTCTAC AcCTCGCCCG TTGTCTCGGT TGATGGCCAG AGTACCCAGG AGCTGCTCAG 
0481 CATACGTAGC TCANCgNCCG AG 
 in silico PCR Fragment
0001 GCACTGAGCC AAATGGCAGC ATAGTCACAA CCGCCCCCAG CAACGGAGAA GTGAGCAGCA 
0061 GCATAGTCGT CGTCGTCAGC AGCAGTAGTA TCAGTAGCAG CAGCGATAGC CCAATCGCTA 
0121 TCCTTCCACA TCCAGATCCA ATCCCATCAA CATCGTTCTC TTCAGCGTCG CAACGAAGTG 
0181 A-AGAGGAGC TACCAGGAAC CTCAGCAGCC TCCAGAACCG ACGAGATGTG CTCTTGTGAT 
0241 AGCCAGAATC TTGCAGCATC CACAGCCGCG ACTTCCAATG GCAATAAACG TAAACGGCGT 
0301 TTAAGCAGCG ATTCAAACGA GGACCCTGAA CTCGGTTTTG AGCCTCCATC AGCTAAGCGC 
0361 -CAGCAGCGA CTGCCCGCTT TGTACGGCAG CGAGCAGGGC AATCTGTCAT CGGTTGCCTC 
0421 CTCGGTCTAC ACCTCGCCCG TTGTCTCGGT TGATGGCCAG AGTACCCAGG AGCTGCTCAG 
0481 CATACGTAGC TCACCGGCCG AG 
 Assemble Data

3938R-3.IR_full       1   GCACTGAGCCAAATGGCAGCATAGTCACAACCGCCCCCAGCAACGGAGAAGTGAGCAGCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3938R-3.in silico     1   GCACTGAGCCAAATGGCAGCATAGTCACAACCGCCCCCAGCAACGGAGAAGTGAGCAGCA 60


3938R-3.IR_full       61  GCATAGTCGTCGTCGTCAGCAGCAGTAGTATCAGTAGCAGCAGCGNTAGNNCAATCGCTA 120
                          ||||||||||||||||||||||||||||||||||||||||||||| |||  |||||||||
3938R-3.in silico     61  GCATAGTCGTCGTCGTCAGCAGCAGTAGTATCAGTAGCAGCAGCGATAGCCCAATCGCTA 120


3938R-3.IR_full       121 TCCTTCCACATCCAGATCCAATCCCATCAACATCGTTCTCTTCAGCGTCGCAACGAAGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3938R-3.in silico     121 TCCTTCCACATCCAGATCCAATCCCATCAACATCGTTCTCTTCAGCGTCGCAACGAAGTG 180


3938R-3.IR_full       181 ANAGAGGAGCTACCAGGAACCTCAGCAGCCTCCAGAACCGACGAGATGTGCTCTTGTGAT 240
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3938R-3.in silico     181 A-AGAGGAGCTACCAGGAACCTCAGCAGCCTCCAGAACCGACGAGATGTGCTCTTGTGAT 240


3938R-3.IR_full       241 AGCCAGAATCTTGCAGCATCCACAGCCGCGACTTCCAATGGCAATAAACGTAAACGGCGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3938R-3.in silico     241 AGCCAGAATCTTGCAGCATCCACAGCCGCGACTTCCAATGGCAATAAACGTAAACGGCGT 300


3938R-3.IR_full       301 TTAAGCAGCGATTCAAACGAGGACCCTGAACTCGGTTTTGAGCCTCCATCAGCTAAGCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3938R-3.in silico     301 TTAAGCAGCGATTCAAACGAGGACCCTGAACTCGGTTTTGAGCCTCCATCAGCTAAGCGC 360


3938R-3.IR_full        361 CAGCAGCGACTGCCCGCTTTGTACGGCAGCGAGCAGGGCAATCTGTCATCGGTTGCCTC 419
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3938R-3.in silico      361 CAGCAGCGACTGCCCGCTTTGTACGGCAGCGAGCAGGGCAATCTGTCATCGGTTGCCTC 419


3938R-3.IR_full       421 CTCGGTCTACACCTCGCCCGTTGTCTCGGTTGATGGCCAGAGTACCCAGGAGCTGCTCAG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3938R-3.in silico     421 CTCGGTCTACACCTCGCCCGTTGTCTCGGTTGATGGCCAGAGTACCCAGGAGCTGCTCAG 479


3938R-3.IR_full       481 CATACGTAGCTCANCGNCCGAG 501
                          ||||||||||||| || |||||
3938R-3.in silico     481 CATACGTAGCTCACCGGCCGAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_165123.2  CG3938-RC, transcript variant C (CycE), mRNA 
100   482  10  NM_057611.4  CG3938-RA, transcript variant A (CycE), mRNA 
100   482  10  NM_165125.2  CG3938-RE, transcript variant E (CycE), mRNA 
100   482  10  NM_165124.2  CG3938-RD, transcript variant D (CycE), mRNA 
33.81   163  NM_057612.4  CG3938-RB, transcript variant B (CycE), mRNA 
0   39  NM_169874.1  CG4608-RA (bnl), mRNA 
0   11  NM_142598.1  CG17190-RA (CG17190), mRNA 
0   NM_168370.1  CG8177-RB, transcript variant B (CG8177), mRNA 
0   NM_140100.1  CG8177-RA, transcript variant A (CG8177), mRNA 
0   NM_206313.1  CG8177-RI, transcript variant I (CG8177), mRNA 
0   NM_206312.1  CG8177-RJ, transcript variant J (CG8177), mRNA 
0   NM_206311.1  CG8177-RK, transcript variant K (CG8177), mRNA 
0   NM_206314.1  CG8177-RH, transcript variant H (CG8177), mRNA 
0   NM_168372.1  CG8177-RF, transcript variant F (CG8177), mRNA 
0   NM_168369.1  CG8177-RG, transcript variant G (CG8177), mRNA 
0   NM_167087.1  CG3203-RA, transcript variant A (RpL17), mRNA 
0   NM_132118.2  CG3203-RD, transcript variant D (RpL17), mRNA 
0   NM_167089.1  CG3203-RC, transcript variant C (RpL17), mRNA 
0   NM_167088.1  CG3203-RB, transcript variant B (RpL17), mRNA 
0   NM_136591.3  CG8213-RA (CG8213), mRNA 
0   10  NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0   10  NM_176037.1  CG32972-RB, transcript variant B (CG32972), mRNA 
0   NM_057379.2  CG8355-RC, transcript variant C (sli), mRNA 
0   NM_057381.2  CG8355-RB, transcript variant B (sli), mRNA 
0   NM_057380.2  CG8355-RA, transcript variant A (sli), mRNA 
0   NM_079985.2  CG5206-RA (bon), mRNA 
0   NM_058053.3  CG6939-RA, transcript variant A (Sbf), mRNA 
0   NM_169430.2  CG6939-RB, transcript variant B (Sbf), mRNA 
0   NM_132372.1  CG15313-RA (CG15313), mRNA 
0   NM_164576.2  CG15427-RD, transcript variant D (tutl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.