National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3936R-3 
 Symbol Full Name Notch 
 CG No CG3936  Old CG No CG3936 
 Synonyms notch, CG3936, EG:163A10.2, CT13012, dNotch, swb, shd, nd, Co, Chp, Ax, spl, fa, 1.1, clone 1.12, n[fah], co, 16-55, 16-178, l(1)N, l(1)Ax, l(1)3Cb, anon-EST:Liang-1.12, EG:140G11.1, N, Notch 
 Accession No (Link to NCBI) NM_057511.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wang W, Liu W, Wang Y, Zhou L, Tang X, Luo H.
Notch signaling regulates neuroepithelial stem cell maintenance and neuroblast formation in Drosophila optic lobe development.
Dev. Biol. (2011) 350(2) 414-28 [ PubMed ID = 21146517 ] [ RRC reference ]

Mao Y, Kucuk B, Irvine KD.
Drosophila lowfat, a novel modulator of Fat signaling.
Development (2009) 136(19) 3223-33 [ PubMed ID = 19710173 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTGGAGGAGTACACGTGTGC 
 Primer Seq. 3'
aatctagaggtaccCCGTGAAGTTCGGTGGACAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTGGAGGAG TACACGTGTG CGTGTGCCAA TGGCTATACA GGTGAACGAT GCGAGACGAA 
0061 GAATCTGTGC GCAAGTTTCT CCCTGCCGGA ATGGAGCCAC CTGCACCGCT TTGGCCGGAA 
0121 GCAGCAGCTT CACCTGCTCC TGTCCGCCGG GCTTCACCGG TGACACCTGT TCCTATGACA 
0181 TCGAGGAGTG CCAGTCGAAT CCGTGCAAAT ACGGCGGCAC ATGTGTCAAC ACCCACGGAT 
0241 CTTACCAGNG CATGTGTcCC ACGGGCTACA CGGGAAAGGA TTGCGACACC AAGTACAAGC 
0301 CCTGCTCGCC ATCGCCGTGC CAGAATGGCG GAATTTGCCG GTCGAACGGT CTGTCCTACG 
0361 AGTGCAAGTG CCCCAAAGGT TTCGAGGGCA AGAACTGCGA ACAGAACTAC GACGATTGCC 
0421 TGGGACATCT TTGCCAGAAC GGAGGAACCT GCATCGATGG CATCTCGGAC TACACCTGCC 
0481 GCTGTCCACC GAACTTCACG G 
 in silico PCR Fragment
0001 ACTGGAGGAG TACACGTGTG CGTGTGCCAA TGGCTATACA GGTGAACGAT GCGAGACGAA 
0061 GAATCTGTGC GCAAG-TTCT CCCTGCCGGA ATGGAGCCAC CTGCACCGCT TTGGCCGGAA 
0121 GCAGCAGCTT CACCTGCTCC TGTCCGCCGG GCTTCACCGG TGACACCTGT TCCTATGACA 
0181 TCGAGGAGTG CCAGTCGAAT CCGTGCAAAT ACGGCGGCAC ATGTGTCAAC ACCCACGGAT 
0241 CTTACCAGTG CATGTGTCCC ACGGGCTACA CGGGAAAGGA TTGCGACACC AAGTACAAGC 
0301 CCTGCTCGCC ATCGCCGTGC CAGAATGGCG GAATTTGCCG GTCGAACGGT CTGTCCTACG 
0361 AGTGCAAGTG CCCCAAAGGT TTCGAGGGCA AGAACTGCGA ACAGAACTAC GACGATTGCC 
0421 TGGGACATCT TTGCCAGAAC GGAGGAACCT GCATCGATGG CATCTCGGAC TACACCTGCC 
0481 GCTGTCCACC GAACTTCACG G 
 Assemble Data

3936R-3.IR_full       1   ACTGGAGGAGTACACGTGTGCGTGTGCCAATGGCTATACAGGTGAACGATGCGAGACGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3936R-3.in silico     1   ACTGGAGGAGTACACGTGTGCGTGTGCCAATGGCTATACAGGTGAACGATGCGAGACGAA 60


3936R-3.IR_full       61  GAATCTGTGCGCAAGTTTCTCCCTGCCGGAATGGAGCCACCTGCACCGCTTTGGCCGGAA 120
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
3936R-3.in silico     61  GAATCTGTGCGCAAG-TTCTCCCTGCCGGAATGGAGCCACCTGCACCGCTTTGGCCGGAA 120


3936R-3.IR_full       121 GCAGCAGCTTCACCTGCTCCTGTCCGCCGGGCTTCACCGGTGACACCTGTTCCTATGACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3936R-3.in silico     121 GCAGCAGCTTCACCTGCTCCTGTCCGCCGGGCTTCACCGGTGACACCTGTTCCTATGACA 180


3936R-3.IR_full       181 TCGAGGAGTGCCAGTCGAATCCGTGCAAATACGGCGGCACATGTGTCAACACCCACGGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3936R-3.in silico     181 TCGAGGAGTGCCAGTCGAATCCGTGCAAATACGGCGGCACATGTGTCAACACCCACGGAT 240


3936R-3.IR_full       241 CTTACCAGNGCATGTGTCCCACGGGCTACACGGGAAAGGATTGCGACACCAAGTACAAGC 300
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
3936R-3.in silico     241 CTTACCAGTGCATGTGTCCCACGGGCTACACGGGAAAGGATTGCGACACCAAGTACAAGC 300


3936R-3.IR_full       301 CCTGCTCGCCATCGCCGTGCCAGAATGGCGGAATTTGCCGGTCGAACGGTCTGTCCTACG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3936R-3.in silico     301 CCTGCTCGCCATCGCCGTGCCAGAATGGCGGAATTTGCCGGTCGAACGGTCTGTCCTACG 360


3936R-3.IR_full       361 AGTGCAAGTGCCCCAAAGGTTTCGAGGGCAAGAACTGCGAACAGAACTACGACGATTGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3936R-3.in silico     361 AGTGCAAGTGCCCCAAAGGTTTCGAGGGCAAGAACTGCGAACAGAACTACGACGATTGCC 420


3936R-3.IR_full       421 TGGGACATCTTTGCCAGAACGGAGGAACCTGCATCGATGGCATCTCGGACTACACCTGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3936R-3.in silico     421 TGGGACATCTTTGCCAGAACGGAGGAACCTGCATCGATGGCATCTCGGACTACACCTGCC 480


3936R-3.IR_full       481 GCTGTCCACCGAACTTCACGG 501
                          |||||||||||||||||||||
3936R-3.in silico     481 GCTGTCCACCGAACTTCACGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  35  140  NM_057511.3  CG3936-RA (N), mRNA 
0.82   33  NM_079803.2  CG6127-RA (Ser), mRNA 
0   NM_057442.3  CG15288-RA, transcript variant A (wb), mRNA 
0   NM_165086.1  CG15288-RB, transcript variant B (wb), mRNA 
0   NM_164770.1  CG7196-RB, transcript variant B (CG7196), mRNA 
0   NM_135301.2  CG7196-RA, transcript variant A (CG7196), mRNA 
0   20  NM_206292.1  CG7526-RB, transcript variant B (CG7526), mRNA 
0   20  NM_139880.2  CG7526-RA, transcript variant A (CG7526), mRNA 
0   NM_137035.1  CG6061-RA (mip120), mRNA 
0   17  84  NM_175960.3  CG33196-RB (dp), mRNA 
0   13  NM_168478.1  CG32094-RA (CG32094), mRNA 
0   NM_135336.2  CG7466-RA (CG7466), mRNA 
0   32  NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_142259.2  CG10278-RA (GATAe), mRNA 
0   10  30  NM_169853.1  CG3619-RB, transcript variant B (Dl), mRNA 
0   10  30  NM_057916.3  CG3619-RA, transcript variant A (Dl), mRNA 
0   55  NM_001043286.1  CG6383-RB, transcript variant B (crb), mRNA 
0   55  NM_079756.2  CG6383-RA, transcript variant A (crb), mRNA 
0   NM_168019.2  CG32279-RA (dro2), mRNA 
0   NM_167938.1  CG9018-RB, transcript variant B (CG9018), mRNA 
0   NM_139444.1  CG9018-RA, transcript variant A (CG9018), mRNA 
0   NM_141723.1  CG6208-RA (CG6208), mRNA 
0   NM_143104.1  CG11856-RA (Nup358), mRNA 
0   NM_168980.1  CG11100-RC, transcript variant C (Mes2), mRNA 
0   NM_168979.2  CG11100-RB, transcript variant B (Mes2), mRNA 
0   NM_139877.1  CG16998-RA (CG16998), mRNA 
0   NM_169114.1  CG1213-RC, transcript variant C (CG1213), mRNA 
0   NM_166257.1  CG5785-RB (thr), mRNA 
0   NM_143558.1  CG2267-RA (CG2267), mRNA 
0   NM_141702.2  CG12806-RA (Teh1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.