National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3925R-3 
 Symbol CG3925  Full Name CG3925 
 CG No CG3925  Old CG No CG3925 
 Synonyms CG3925 
 Accession No (Link to NCBI) NM_141716.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Wakabayashi S, Sawamura N, Voelzmann A, Broemer M, Asahi T, Hoch M.
Ohgata, the Single Drosophila Ortholog of Human Cereblon, Regulates Insulin Signaling-Dependent Organismic Growth.
J Biol Chem. (2016) [ PubMed ID = 27702999 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCGGCAGGTAGACGTGATA 
 Primer Seq. 3'
aatctagaggtaccTTGGTGTCAAAGCCAATGTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NATCGGCAGG TAGACGTGAT AGAACAGGCT TGGAACAATG CAATGCCAGA CGAGCCGTCA 
0061 CCGCCGGCAG AAGATGCCTT CCAAGATCCA CTGGCCACCG ATGGTGAGGG AGGGGATGCA 
0121 CTTGAGGCCA TGGTAGAGAA CGTTTTGCAG GACGACACAG CAAGCGAGGG CAGTCATCCC 
0181 AGCAGTGACA TGTCTCTGGA AAGTCCAGGA AGTGAAGATG ATTCCGATCT GGAGAGCCTG 
0241 CCCCATTGGA TGATTCCGCA GAACCGACTG CGCTCCGCCG TAGACATGAT GGTCTCGCAA 
0301 GCCCGCAATC GGGATGGTGG AATCGCTGCA CTGCTCAGTG GGGACAACTT CCTACAGCGA 
0361 GTGCGTAGCA TGGTTCTTTA GCCAGGAGCG ACGGCGCAGT cGCACAAGCG AGGAAACGAG 
0421 CCAGGaGGCT GCCGAGCAGC CCGTTGATCC ACCGCCACAG CAGCCACCTC GACCNCCAAT 
0481 CGACATTGGC TTTGACACCA A 
 in silico PCR Fragment
0001 GATCGGCAGG TAGACGTGAT AGAACAGGCT TGGAACAATG CAATGCCAGA CGAGCCGTCA 
0061 CCGCCGGCAG AAGATGCCTT CCAAGATCCA CTGGCCACCG ATGGTGAGGG AGGGGATGCA 
0121 CTTGAGGCCA TGGTAGAGAA CGTTTTGCAG GACGACACAG CAAGCGAGGG CAGTCATCCC 
0181 AGCAGTGACA TGTCTCTGGA AAGTCCAGGA AGTGAAGATG ATTCCGATCT GGAGAGCCTG 
0241 CCCCATTGGA TGATTCCGCA GAACCGACTG CGCTCCGCCG TAGACATGAT GGTCTCGCAA 
0301 GCCCGCAATC GGGATGGTGG AATCGCTGCA CTGCTCAGTG GGGACAACTT CCTACAGCGA 
0361 GTGCGTAGCA TGG-TCTTTA GCCAGGAGCG ACGGCGCAGT CGCACAAGCG AGGAAACGAG 
0421 CCAGGAGGCT GCCGAGCAGC CCGTTGATCC ACCGCCACAG CAGCCACCTC GACCACCAAT 
0481 CGACATTGGC TTTGACACCA A 
 Assemble Data

3925R-3.IR_full        1   ATCGGCAGGTAGACGTGATAGAACAGGCTTGGAACAATGCAATGCCAGACGAGCCGTCA 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3925R-3.in silico      1   ATCGGCAGGTAGACGTGATAGAACAGGCTTGGAACAATGCAATGCCAGACGAGCCGTCA 59


3925R-3.IR_full       61  CCGCCGGCAGAAGATGCCTTCCAAGATCCACTGGCCACCGATGGTGAGGGAGGGGATGCA 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3925R-3.in silico     61  CCGCCGGCAGAAGATGCCTTCCAAGATCCACTGGCCACCGATGGTGAGGGAGGGGATGCA 119


3925R-3.IR_full       121 CTTGAGGCCATGGTAGAGAACGTTTTGCAGGACGACACAGCAAGCGAGGGCAGTCATCCC 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3925R-3.in silico     121 CTTGAGGCCATGGTAGAGAACGTTTTGCAGGACGACACAGCAAGCGAGGGCAGTCATCCC 179


3925R-3.IR_full       181 AGCAGTGACATGTCTCTGGAAAGTCCAGGAAGTGAAGATGATTCCGATCTGGAGAGCCTG 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3925R-3.in silico     181 AGCAGTGACATGTCTCTGGAAAGTCCAGGAAGTGAAGATGATTCCGATCTGGAGAGCCTG 239


3925R-3.IR_full       241 CCCCATTGGATGATTCCGCAGAACCGACTGCGCTCCGCCGTAGACATGATGGTCTCGCAA 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3925R-3.in silico     241 CCCCATTGGATGATTCCGCAGAACCGACTGCGCTCCGCCGTAGACATGATGGTCTCGCAA 299


3925R-3.IR_full       301 GCCCGCAATCGGGATGGTGGAATCGCTGCACTGCTCAGTGGGGACAACTTCCTACAGCGA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3925R-3.in silico     301 GCCCGCAATCGGGATGGTGGAATCGCTGCACTGCTCAGTGGGGACAACTTCCTACAGCGA 359


3925R-3.IR_full       361 GTGCGTAGCATGGTTCTTTAGCCAGGAGCGACGGCGCAGTCGCACAAGCGAGGAAACGAG 419
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
3925R-3.in silico     361 GTGCGTAGCATGG-TCTTTAGCCAGGAGCGACGGCGCAGTCGCACAAGCGAGGAAACGAG 419


3925R-3.IR_full       421 CCAGGAGGCTGCCGAGCAGCCCGTTGATCCACCGCCACAGCAGCCACCTCGACCNCCAAT 479
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
3925R-3.in silico     421 CCAGGAGGCTGCCGAGCAGCCCGTTGATCCACCGCCACAGCAGCCACCTCGACCACCAAT 479


3925R-3.IR_full       481 CGACATTGGCTTTGACACCAA 500
                          |||||||||||||||||||||
3925R-3.in silico     481 CGACATTGGCTTTGACACCAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141716.1  CG3925-RA (CG3925), mRNA 
0.2   NM_142992.1  CG6454-RB, transcript variant B (CG6454), mRNA 
0   NM_143222.1  CG14237-RA (CG14237), mRNA 
0   NM_135791.1  CG15639-RA (CG15639), mRNA 
0   NM_132679.1  CG12176-RA (Lig4), mRNA 
0   NM_140372.1  CG14115-RA (CG14115), mRNA 
0   NM_141557.1  CG8043-RA (CG8043), mRNA 
0   NM_143729.2  CG17342-RA, transcript variant A (Lk6), mRNA 
0   NM_176211.1  CG33197-RB, transcript variant B (mbl), mRNA 
0   NM_168628.1  CG7656-RA, transcript variant A (CG7656), mRNA 
0   NM_140526.3  CG7656-RB, transcript variant B (CG7656), mRNA 
0   NM_168627.1  CG7656-RC, transcript variant C (CG7656), mRNA 
0   NM_135453.1  CG13114-RA (CG13114), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
0   NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
0   NM_206148.1  CG30460-RD, transcript variant D (CG30460), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_176682.1  CG2930-RD, transcript variant D (CG2930), mRNA 
0   NM_164688.1  CG31640-RA (CG31640), mRNA 
0   NM_079149.3  CG17046-RA, transcript variant A (klar), mRNA 
0   NM_001043111.1  CG17046-RB, transcript variant B (klar), mRNA 
0   NM_142655.1  CG15690-RA (CG15690), mRNA 
0   57  NM_168664.1  CG4877-RA, transcript variant A (CG4877), mRNA 
0   57  NM_140632.2  CG4877-RB, transcript variant B (CG4877), mRNA 
0   NM_176148.1  CG33145-RB, transcript variant B (CG33145), mRNA 
0   NM_176149.1  CG33145-RA, transcript variant A (CG33145), mRNA 
0   NM_137128.2  CG12864-RA, transcript variant A (Su(var)2-HP2), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
VM
VB
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.