National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3925R-3 
 Symbol CG3925  Full Name CG3925 
 CG No CG3925  Old CG No CG3925 
 Synonyms CG3925 
 Accession No (Link to NCBI) NM_141716.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Wakabayashi S, Sawamura N, Voelzmann A, Broemer M, Asahi T, Hoch M.
Ohgata, the Single Drosophila Ortholog of Human Cereblon, Regulates Insulin Signaling-Dependent Organismic Growth.
J. Biol. Chem. (2016) [ PubMed ID = 27702999 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   ATCGGCAGGTAGACGTGATAGAACAGGCTTGGAACAATGCAATGCCAGACGAGCCGTCA 59

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGCCGGCAGAAGATGCCTTCCAAGATCCACTGGCCACCGATGGTGAGGGAGGGGATGCA 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTTGAGGCCATGGTAGAGAACGTTTTGCAGGACGACACAGCAAGCGAGGGCAGTCATCCC 179

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCAGTGACATGTCTCTGGAAAGTCCAGGAAGTGAAGATGATTCCGATCTGGAGAGCCTG 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCCCATTGGATGATTCCGCAGAACCGACTGCGCTCCGCCGTAGACATGATGGTCTCGCAA 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCCGCAATCGGGATGGTGGAATCGCTGCACTGCTCAGTGGGGACAACTTCCTACAGCGA 359

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTGCGTAGCATGG-TCTTTAGCCAGGAGCGACGGCGCAGTCGCACAAGCGAGGAAACGAG 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     421 CCAGGAGGCTGCCGAGCAGCCCGTTGATCCACCGCCACAGCAGCCACCTCGACCACCAAT 479

3925R-3.IR_full       481 CGACATTGGCTTTGACACCAA 500
                          ||||||||||||||||||||| silico     481 CGACATTGGCTTTGACACCAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141716.1  CG3925-RA (CG3925), mRNA 
0.2   NM_142992.1  CG6454-RB, transcript variant B (CG6454), mRNA 
0   NM_143222.1  CG14237-RA (CG14237), mRNA 
0   NM_135791.1  CG15639-RA (CG15639), mRNA 
0   NM_132679.1  CG12176-RA (Lig4), mRNA 
0   NM_140372.1  CG14115-RA (CG14115), mRNA 
0   NM_141557.1  CG8043-RA (CG8043), mRNA 
0   NM_143729.2  CG17342-RA, transcript variant A (Lk6), mRNA 
0   NM_176211.1  CG33197-RB, transcript variant B (mbl), mRNA 
0   NM_168628.1  CG7656-RA, transcript variant A (CG7656), mRNA 
0   NM_140526.3  CG7656-RB, transcript variant B (CG7656), mRNA 
0   NM_168627.1  CG7656-RC, transcript variant C (CG7656), mRNA 
0   NM_135453.1  CG13114-RA (CG13114), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
0   NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
0   NM_206148.1  CG30460-RD, transcript variant D (CG30460), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_176682.1  CG2930-RD, transcript variant D (CG2930), mRNA 
0   NM_164688.1  CG31640-RA (CG31640), mRNA 
0   NM_079149.3  CG17046-RA, transcript variant A (klar), mRNA 
0   NM_001043111.1  CG17046-RB, transcript variant B (klar), mRNA 
0   NM_142655.1  CG15690-RA (CG15690), mRNA 
0   57  NM_168664.1  CG4877-RA, transcript variant A (CG4877), mRNA 
0   57  NM_140632.2  CG4877-RB, transcript variant B (CG4877), mRNA 
0   NM_176148.1  CG33145-RB, transcript variant B (CG33145), mRNA 
0   NM_176149.1  CG33145-RA, transcript variant A (CG33145), mRNA 
0   NM_137128.2  CG12864-RA, transcript variant A (Su(var)2-HP2), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.