National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3922R-2 
 Symbol RpS17  Full Name Ribosomal protein S17 
 CG No CG3922  Old CG No CG3922 
 Synonyms M(3)i(55), CG3922, M(3)RpS17, RPS17, M(3)67C, M(3)i[55], D9, M(3)i, M(3)67, M(3L)i[55], unnamed, M(3L)i, rpS17, l(3)dtOA4, l(3)67BDo, anon-EST:Posey48, M(3)q, M(3)S33, BcDNA:RE44119, RpS17 
 Accession No (Link to NCBI) NM_079278.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Akai N, Igaki T, Ohsawa S.
Wingless signaling regulates winner/loser status in Minute cell competition.
Genes Cells (2018) 23(3) 234-240 [ PubMed ID = 29431244 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGTCGCGTACGAACCAAG 
 Primer Seq. 3'
aatctagaggtaccCGACGACCAAAGTTGTTGGTG 
 Predicted Fragment Size
389 
 IR fragment full Seq
0001 ATGGGTCGCG TACGAACCAA GACGGTGAAG AAGGCCGCTA AGGTCATCAT CGAGAAGTAC 
0061 TACACTCGCC TGACGTTGGA CTTCCACACC AACAAGCGCA TCTGCGAGGA GGTGGCCATC 
0121 ATCCCCACCA ANGCCCCTGC GCAACAAGAT TGCCGGCTAT GTCACCCATT TGATGGGCCG 
0181 CCTGCGTCAC TCCCAGGTGC GTGGTATCTC CATCAAGTTG CAGGAGGAGG AGCGTGAGCG 
0241 TCGTGACANA CTACGTCCCG GCCGTCTCCG CTCTGGAGCA GGACATCATC GAGGTCGACG 
0301 CCGACACCAA GGAGATGTTG AAGCTTCTGG ACTTCCACAA CATCCGTGGC CTGCAGCTCA 
0361 CCCAGCCCAA CACCAACAAC TTTGGTCGTC G 
 in silico PCR Fragment
0001 ATGGGTCGCG TACGAACCAA GACGGTGAAG AAGGCCGCTA AGGTCATCAT CGAGAAGTAC 
0061 TACACTCGCC TGACGTTGGA CTTCCACACC AACAAGCGCA TCTGCGAGGA GGTGGCCATC 
0121 ATTCCCACCA A-GCCCCTGC GCAACAAGAT TGCCGGCTAT GTCACCCATT TGATGGGCCG 
0181 CCTGCGTCAC TCCCAGGTGC GTGGTATCTC CATCAAGTTG CAGGAGGAGG AGCGTGAGCG 
0241 TCGTGACA-A CTACGTCCCG GCCGTCTCCG CTCTGGAGCA GGACATCATC GAGGTCGACG 
0301 CCGACACCAA GGAGATGTTG AAGCTTCTGG ACTTCCACAA CATCCGTGGC CTGCAGCTCA 
0361 CCCAGCCCAA CACCAACAAC TTTGGTCGTC G 
 Assemble Data

3922R-2.IR_full       1   ATGGGTCGCGTACGAACCAAGACGGTGAAGAAGGCCGCTAAGGTCATCATCGAGAAGTAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3922R-2.in silico     1   ATGGGTCGCGTACGAACCAAGACGGTGAAGAAGGCCGCTAAGGTCATCATCGAGAAGTAC 60


3922R-2.IR_full       61  TACACTCGCCTGACGTTGGACTTCCACACCAACAAGCGCATCTGCGAGGAGGTGGCCATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3922R-2.in silico     61  TACACTCGCCTGACGTTGGACTTCCACACCAACAAGCGCATCTGCGAGGAGGTGGCCATC 120


3922R-2.IR_full       121 ATCCCCACCAANGCCCCTGCGCAACAAGATTGCCGGCTATGTCACCCATTTGATGGGCCG 180
                          || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
3922R-2.in silico     121 ATTCCCACCAA-GCCCCTGCGCAACAAGATTGCCGGCTATGTCACCCATTTGATGGGCCG 180


3922R-2.IR_full       181 CCTGCGTCACTCCCAGGTGCGTGGTATCTCCATCAAGTTGCAGGAGGAGGAGCGTGAGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3922R-2.in silico     181 CCTGCGTCACTCCCAGGTGCGTGGTATCTCCATCAAGTTGCAGGAGGAGGAGCGTGAGCG 240


3922R-2.IR_full       241 TCGTGACANACTACGTCCCGGCCGTCTCCGCTCTGGAGCAGGACATCATCGAGGTCGACG 300
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
3922R-2.in silico     241 TCGTGACA-ACTACGTCCCGGCCGTCTCCGCTCTGGAGCAGGACATCATCGAGGTCGACG 300


3922R-2.IR_full       301 CCGACACCAAGGAGATGTTGAAGCTTCTGGACTTCCACAACATCCGTGGCCTGCAGCTCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3922R-2.in silico     301 CCGACACCAAGGAGATGTTGAAGCTTCTGGACTTCCACAACATCCGTGGCCTGCAGCTCA 360


3922R-2.IR_full       361 CCCAGCCCAACACCAACAACTTTGGTCGTCG 391
                          |||||||||||||||||||||||||||||||
3922R-2.in silico     361 CCCAGCCCAACACCAACAACTTTGGTCGTCG 391

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   371  NM_079278.2  CG3922-RB (RpS17), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_142448.2  CG8064-RA (CG8064), mRNA 
0   NM_169683.1  CG31291-RA, transcript variant A (CG31291), mRNA 
0   NM_169682.1  CG31291-RB, transcript variant B (CG31291), mRNA 
0   NM_165878.1  CG30046-RB (CG30046), mRNA 
0   NM_167313.1  CG2467-RB, transcript variant B (CG2467), mRNA 
0   NM_132540.1  CG2467-RA, transcript variant A (CG2467), mRNA 
0   NM_134584.2  CG32512-RA (CG32512), mRNA 
0   NM_170536.2  CG2048-RB, transcript variant B (dco), mRNA 
0   NM_170535.1  CG2048-RA, transcript variant A (dco), mRNA 
0   NM_079863.2  CG2048-RC, transcript variant C (dco), mRNA 
0   NM_078539.2  CG8971-RA (fh), mRNA 
0   NM_136556.2  CG14749-RA (CG14749), mRNA 
0   NM_169394.1  CG17230-RB, transcript variant B (CG17230), mRNA 
0   NM_141820.1  CG17230-RA, transcript variant A (CG17230), mRNA 
0   12  NM_135304.2  CG7154-RA (CG7154), mRNA 
0   NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
0   NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
0   NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
0   NM_165917.1  CG8815-RD, transcript variant D (Sin3A), mRNA 
0   NM_057268.3  CG6944-RA (Lam), mRNA 
0   NM_080170.2  CG11156-RA (mus101), mRNA 
0   NM_057505.3  CG3644-RA, transcript variant A (bic), mRNA 
0   NM_165954.1  CG3644-RB, transcript variant B (bic), mRNA 
0   NM_169644.1  CG4843-RB, transcript variant B (Tm2), mRNA 
0   NM_169645.2  CG4843-RC, transcript variant C (Tm2), mRNA 
0   NM_079637.4  CG4843-RA, transcript variant A (Tm2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.