National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3886R-4 
 Symbol Psc  Full Name Posterior sex combs 
 CG No CG3886  Old CG No CG3886 
 Synonyms psc, CG3886, dPSC, Psc1, PSC, l(2)49Ea, vr14, Su(z)2-C, l(2)Psc, 49Ea, l(2)vr14, D-Bmi, Psc 
 Accession No (Link to NCBI) NM_079001.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Shih HT, Chen WY, Liu KY, Shih ZS, Chen YJ, Hsieh PC, Kuo KL, Huang KH, Hsu PH, Liu YW, Chan SP, Lee HH, Tsai YC, Wu JT.
dBRWD3 Regulates Tissue Overgrowth and Ectopic Gene Expression Caused by Polycomb Group Mutations.
PLoS Genet. (2016) 12(9) e1006262 [ PubMed ID = 27588417 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCACACACAACAAAAGTCGC 
 Primer Seq. 3'
aatctagaggtaccTGATGATGAGGAGGACGAGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCACACACA ACAAAAGTCG CAGTTGTCAA CGTTGGCGAA AACAACAACG ACAACGGCAA 
0061 CGAATAAGGC GGCCAAAAGC GTTGTCAGCA ATGCAAATAG CAGTGGCAAC AATTCGAGCA 
0121 AAAAGCTGGC TTTGTCTCAG TCTCAGAAAA CAACAACAAC AACAACACCA CCAACGACGA 
0181 CGACAACAAC AACAGCAGCA GCAGCAGCAG AGGCAACAAC TAATGCTGAT AAAATGCAAA 
0241 AGCAACAGCA ACTGAAGCAG CAACTTTTCG CTGCCTGCAG CATTAAAGTA AAAAAGTGAA 
0301 AACACATTAG CAACTACTGC GAATGCAGCA TTAGCAGCAG CAACAACCAC AACAACAACA 
0361 GCAACACCAG CACTTGCCAC CGGNAAAGCA GCAAAAACAA TATTAGAAAA CGGCATAAAG 
0421 AAGGAATCCA CGCCTCCGGC TGTTCGAATC CGTTGAGGCC TCCTCCTCAT CGTCATCCTC 
0481 CTCCTCGTCC TCCTCATCAT CA 
 in silico PCR Fragment
0001 CTCACACACA ACAAAAGTCG CAGTTGTCAA CGTTGGCGAA AACAACAACG ACAACGGCAA 
0061 CGAATAAGGC GGCCAAAAGC GTTGTCAGCA ATGCAAATAG CAGTGGCAAC AATTCGAGCA 
0121 AAAAGCTGGC TTTGTCTCAG TCTCAGAAAA CAACAACAAC AACAACACCA CCAACGACGA 
0181 CGACAACAAC AACAGCAGCA GCAGCAGCAG AGGCAACAAC TAATGCTGAT AAAATGCAAA 
0241 AGCAACAGCA ACTGAAGCAG CAACTTTTCG CTGCCTGCAG CATTAAAGT- AAAAAGTGAA 
0301 AACACATTAG CAACTACTGC GAATGCAGCA TTAGCAGCAG CAACAACCAC AACAACAACA 
0361 GCAACACCAG CACTTGCCAC CGGCAAAGCA GCAAAAACAA TATTAGAAAA CGGCATAAAG 
0421 AAGGAATCCA CGCCTCCGGC TG-TCGAATC CGTTGAGGCC TCCTCCTCAT CGTCATCCTC 
0481 CTCCTCGTCC TCCTCATCAT CA 
 Assemble Data

3886R-4.IR_full       1   CTCACACACAACAAAAGTCGCAGTTGTCAACGTTGGCGAAAACAACAACGACAACGGCAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3886R-4.in silico     1   CTCACACACAACAAAAGTCGCAGTTGTCAACGTTGGCGAAAACAACAACGACAACGGCAA 60


3886R-4.IR_full       61  CGAATAAGGCGGCCAAAAGCGTTGTCAGCAATGCAAATAGCAGTGGCAACAATTCGAGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3886R-4.in silico     61  CGAATAAGGCGGCCAAAAGCGTTGTCAGCAATGCAAATAGCAGTGGCAACAATTCGAGCA 120


3886R-4.IR_full       121 AAAAGCTGGCTTTGTCTCAGTCTCAGAAAACAACAACAACAACAACACCACCAACGACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3886R-4.in silico     121 AAAAGCTGGCTTTGTCTCAGTCTCAGAAAACAACAACAACAACAACACCACCAACGACGA 180


3886R-4.IR_full       181 CGACAACAACAACAGCAGCAGCAGCAGCAGAGGCAACAACTAATGCTGATAAAATGCAAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3886R-4.in silico     181 CGACAACAACAACAGCAGCAGCAGCAGCAGAGGCAACAACTAATGCTGATAAAATGCAAA 240


3886R-4.IR_full       241 AGCAACAGCAACTGAAGCAGCAACTTTTCGCTGCCTGCAGCATTAAAGTAAAAAAGTGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
3886R-4.in silico     241 AGCAACAGCAACTGAAGCAGCAACTTTTCGCTGCCTGCAGCATTAAAGT-AAAAAGTGAA 300


3886R-4.IR_full       301 AACACATTAGCAACTACTGCGAATGCAGCATTAGCAGCAGCAACAACCACAACAACAACA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3886R-4.in silico     301 AACACATTAGCAACTACTGCGAATGCAGCATTAGCAGCAGCAACAACCACAACAACAACA 360


3886R-4.IR_full       361 GCAACACCAGCACTTGCCACCGGNAAAGCAGCAAAAACAATATTAGAAAACGGCATAAAG 420
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
3886R-4.in silico     361 GCAACACCAGCACTTGCCACCGGCAAAGCAGCAAAAACAATATTAGAAAACGGCATAAAG 420


3886R-4.IR_full       421 AAGGAATCCACGCCTCCGGCTGTTCGAATCCGTTGAGGCCTCCTCCTCATCGTCATCCTC 480
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
3886R-4.in silico     421 AAGGAATCCACGCCTCCGGCTG-TCGAATCCGTTGAGGCCTCCTCCTCATCGTCATCCTC 480


3886R-4.IR_full       481 CTCCTCGTCCTCCTCATCATCA 502
                          ||||||||||||||||||||||
3886R-4.in silico     481 CTCCTCGTCCTCCTCATCATCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  30  123  415  NM_079001.2  CG3886-RA (Psc), mRNA 
10.37   50  317  1202  2980  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
10.37   50  317  1202  2978  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
10.37   50  317  1202  2978  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
10.37   50  252  760  1778  NM_168571.2  CG32133-RA (CG32133), mRNA 
5.6   27  70  193  681  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
5.6   27  66  163  591  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
5.6   27  66  163  589  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
5.18   25  86  284  730  NM_137212.2  CG30089-RA (CG30089), mRNA 
4.97   24  143  394  687  NM_168240.1  CG32365-RA (CG32365), mRNA 
4.97   24  69  300  958  NM_079903.2  CG15319-RB (nej), mRNA 
4.56   22  82  245  724  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
4.56   22  82  245  724  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
4.56   22  43  112  386  NM_057489.3  CG4722-RA (bib), mRNA 
4.14   20  153  508  1276  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
4.14   20  147  455  1130  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
4.14   20  61  176  479  NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
4.14   20  61  176  479  NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
3.94   19  153  459  845  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
3.94   19  127  500  1248  NM_001038734.1  CG16902-RC (Hr4), mRNA 
3.94   19  124  422  1214  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
3.94   19  124  422  1214  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
3.73   18  89  245  689  NM_132246.2  CG10555-RA (CG10555), mRNA 
3.73   18  73  259  679  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
3.73   18  73  259  679  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
3.31   16  60  202  487  NM_135793.2  CG16970-RA (CG16970), mRNA 
3.31   16  54  186  692  NM_168179.1  CG32394-RA (CG32394), mRNA 
3.31   16  31  81  237  NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
3.31   16  31  81  237  NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
3.11   15  108  296  504  NM_140928.2  CG32223-RA (CG32223), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.