National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3874R-2 
 Symbol frc  Full Name fringe connection 
 CG No CG3874  Old CG No CG3874 
 Synonyms UDP-GlcNAc/UDP-GlcUA, ust74C, UST74C, l(3)10098, l(3)02619, l(3)00073, CG3874, l(3)j2E3, l(3)L6750, l(3)S070006, anon-WO0172774.7, anon-WO0172774.5, frc, FRC 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pharate adult 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGCGGAGAGCGATGTCGGAAACAGGGAGCTGGAGGAGAAGATGGGCGGATCGGCGGATCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTCATCGCTGCTCGATGGATCCGGTTCGAAGGAGCTGAGTCACCGGGAACGCGAGGACTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGCGTTGTTCGTCAAGAAGATCGGGAGCGCCTTGTTCTATGGCTTGTCCTCCTTCATGAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TACGGTGGTAAACAAGACGGTGCTTACCTCCTACCACTTCCCCTCGTTCCTGTTCCTCAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCTCGGGCAACTTACTGCTAGCATTGTGGTCCTGGGCATGGGCAAGCGCCTGAAATTGGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAACTTTCCCCCTCTGCAGAGGAATACCTTCGCCAAGATCTTTCCGCTGCCACTGATATT 360

                          ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     361 TCTGGGAAACATGATGTTTGGACTGGGTGGCACAAAAACCTTGAGTCTGCCCATGTTCGC 420

                          |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| silico     421 AGCCCTACGACGCTTCTCTATCCTGATGACCATGCTGCTGGAGCTCAAGATCCTGGGACT 480

3874R-2.IR full       481 GCGACCTTCGAATGCGGTTC 500
                          |||||||||||||||||||| silico     481 GCGACCTTCGAATGCGGTTC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079402.2  fringe connection CG3874-RA (frc), mRNA 
0.41  NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0.41  NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0.41  NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
NM_132217.2  CG10958-RA (CG10958), mRNA 
NM_132146.1  inx6 CG17063-RA (inx6), mRNA 
NM_057716.3  peanut CG8705-RA, transcript variant A (pnut), mRNA 
NM_165597.1  peanut CG8705-RB, transcript variant B (pnut), mRNA 
NM_143564.1  CG11313-RA (CG11313), mRNA 
NM_167278.1  Kinesin associated protein 3 CG11759-RA (Kap3), mRNA 
NM_166630.1  CG5594-RD, transcript variant D (CG5594), mRNA 
NM_166631.1  CG5594-RA, transcript variant A (CG5594), mRNA 
NM_137605.2  CG13872-RA (CG13872), mRNA 
NM_166313.1  Vha100-3 CG30329-RA (Vha100-3), mRNA 
NM_167063.1  Longevity assurance gene 1 CG3576-RA, transcript variant A (Lag1), mRNA 
NM_144269.2  Longevity assurance gene 1 CG3576-RB, transcript variant B (Lag1), mRNA 
NM_169181.1  CG32468-RA (CG32468), mRNA 
NM_140897.2  Mi-2 CG8103-RA, transcript variant A (Mi-2), mRNA 
NM_001014591.1  Mi-2 CG8103-RB, transcript variant B (Mi-2), mRNA 
NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 
NM_141402.1  CG15186-RA, transcript variant A (CG15186), mRNA 
NM_080369.2  Glyceraldehyde 3 phosphate dehydrogenase 1 CG12055-RA, transcript variant A (Gapdh1), mRNA 
NM_001038847.1  Glyceraldehyde 3 phosphate dehydrogenase 1 CG12055-RB, transcript variant B (Gapdh1), mRNA 
NM_079067.2  coracle CG11949-RA, transcript variant A (cora), mRNA 
NM_166338.1  coracle CG11949-RD, transcript variant D (cora), mRNA 
NM_166337.1  coracle CG11949-RB, transcript variant B (cora), mRNA 
NM_166336.1  coracle CG11949-RC, transcript variant C (cora), mRNA 
10  NM_169645.2  Tropomyosin 2 CG4843-RC, transcript variant C (Tm2), mRNA 
10  NM_169644.1  Tropomyosin 2 CG4843-RB, transcript variant B (Tm2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.