National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3856R-1 
 Symbol Oamb  Full Name Octopamine receptor in mushroom bodies 
 CG No CG3856  Old CG No CG3856 
 Synonyms OAMB, Dm-OAMB, Dmoa1, DmOAMB, oamb, Oamb b, Oamb a, DmOCT1B, OAMB-1a, CG15698, CG3856, Oamb 
 Accession No (Link to NCBI) NM_169913.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Manjila SB, Kuruvilla M, Ferveur JF, Sane SP, Hasan G.
Extended Flight Bouts Require Disinhibition from GABAergic Mushroom Body Neurons.
Curr. Biol. (2018) [ PubMed ID = 30612904 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACCAGCCAATCTGATCTCCC 
 Primer Seq. 3'
aatctagaggtaccCATCGTGGTGGTGTAGTAAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACCAGCCAA TCTGATCTCC CTGGCCGTAC TCGAGTTCAT CAACGTTCTG GTCATCGGTG 
0061 GCAACTGcCT CGTGATTGCC GCCGTCTTCT GTTCGAATAA GTTGAGGAGT GTGACGAACT 
0121 TCTTTATTGT CAACCTAGCT GTGGCCGATC TTCTGGTGGG TTTGGCCGTC CTACCCTTCT 
0181 CAGCCACCTG GGANGNCTTC AAGGTTTGGA TATTCGGCGA TCTCTGGTGC CGCATTTGGC 
0241 TNGCTGTCGA TGTCTGGATG TGCACGGCAT CNGATCCTGA ATCTGTGTGC CATATCANCT 
0301 GGACCGCTAT GTGGCGGTCA CACGACCCGT CACCTACCCA AGCATAATGT CCACGAAGAA 
0361 GGCCAAGTCC TTAATCGCCG GCATTTGGGT ACTCTCATTT TTTATTTGCT TTCCGCCGCT 
0421 AGTCGGCTGG AAGGATCAAA AGGCGGTTAT ACAGCCGACC TATCCAAAGG GAAACCATAC 
0481 GCTTTACTAC ACCACCACGA TG 
 in silico PCR Fragment
0001 AACCAGCCAA TCTGATCTCC CTGGCCGTAC TCGAGTTCAT CAACGTTCTG GTCATCGGTG 
0061 GCAACTGCCT CGTGATTGCC GCCGTCTTCT GTTCGAATAA GTTGAGGAGT GTGACGAACT 
0121 TCTTTATTGT CAACCTAGCT GTGGCCGATC TTCTGGTGGG TTTGGCCGTC CTACCCTTCT 
0181 CAGCCACCTG GGAAGTCTTC AAGGTTTGGA TATTCGGCGA TCTCTGGTGC CGCATTTGGC 
0241 TGGCTGTCGA TGTCTGGATG TGCACGGCAT C-GATCCTGA ATCTGTGTGC CATATCA-CT 
0301 GGACCGCTAT GTGGCGGTCA CACGACCCGT CACCTACCCA AGCATAATGT CCACGAAGAA 
0361 GGCCAAGTCC TTAATCGCCG GCATTTGGGT ACTCTCATTT TTTATTTGCT TTCCGCCGCT 
0421 AGTCGGCTGG AAGGATCAAA AGGCGGTTAT ACAGCCGACC TATCCAAAGG GAAACCATAC 
0481 GCTTTACTAC ACCACCACGA TG 
 Assemble Data

3856R-1.IR_full       1   AACCAGCCAATCTGATCTCCCTGGCCGTACTCGAGTTCATCAACGTTCTGGTCATCGGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3856R-1.in silico     1   AACCAGCCAATCTGATCTCCCTGGCCGTACTCGAGTTCATCAACGTTCTGGTCATCGGTG 60


3856R-1.IR_full       61  GCAACTGCCTCGTGATTGCCGCCGTCTTCTGTTCGAATAAGTTGAGGAGTGTGACGAACT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3856R-1.in silico     61  GCAACTGCCTCGTGATTGCCGCCGTCTTCTGTTCGAATAAGTTGAGGAGTGTGACGAACT 120


3856R-1.IR_full       121 TCTTTATTGTCAACCTAGCTGTGGCCGATCTTCTGGTGGGTTTGGCCGTCCTACCCTTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3856R-1.in silico     121 TCTTTATTGTCAACCTAGCTGTGGCCGATCTTCTGGTGGGTTTGGCCGTCCTACCCTTCT 180


3856R-1.IR_full       181 CAGCCACCTGGGANGNCTTCAAGGTTTGGATATTCGGCGATCTCTGGTGCCGCATTTGGC 240
                          ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||
3856R-1.in silico     181 CAGCCACCTGGGAAGTCTTCAAGGTTTGGATATTCGGCGATCTCTGGTGCCGCATTTGGC 240


3856R-1.IR_full       241 TNGCTGTCGATGTCTGGATGTGCACGGCATCNGATCCTGAATCTGTGTGCCATATCANCT 300
                          | ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||
3856R-1.in silico     241 TGGCTGTCGATGTCTGGATGTGCACGGCATC-GATCCTGAATCTGTGTGCCATATCA-CT 300


3856R-1.IR_full       301 GGACCGCTATGTGGCGGTCACACGACCCGTCACCTACCCAAGCATAATGTCCACGAAGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3856R-1.in silico     301 GGACCGCTATGTGGCGGTCACACGACCCGTCACCTACCCAAGCATAATGTCCACGAAGAA 360


3856R-1.IR_full       361 GGCCAAGTCCTTAATCGCCGGCATTTGGGTACTCTCATTTTTTATTTGCTTTCCGCCGCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3856R-1.in silico     361 GGCCAAGTCCTTAATCGCCGGCATTTGGGTACTCTCATTTTTTATTTGCTTTCCGCCGCT 420


3856R-1.IR_full       421 AGTCGGCTGGAAGGATCAAAAGGCGGTTATACAGCCGACCTATCCAAAGGGAAACCATAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3856R-1.in silico     421 AGTCGGCTGGAAGGATCAAAAGGCGGTTATACAGCCGACCTATCCAAAGGGAAACCATAC 480


3856R-1.IR_full       481 GCTTTACTACACCACCACGATG 502
                          ||||||||||||||||||||||
3856R-1.in silico     481 GCTTTACTACACCACCACGATG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169914.1  CG3856-RC, transcript variant C (Oamb), mRNA 
100   482  NM_169913.1  CG3856-RA, transcript variant A (Oamb), mRNA 
100   482  NM_079930.2  CG3856-RB, transcript variant B (Oamb), mRNA 
1.65   10  NM_079860.2  CG12073-RA (5-HT7), mRNA 
0   13  NM_079695.2  CG7485-RA (TyrR), mRNA 
0   NM_143133.2  CG11908-RA (rha), mRNA 
0   NM_134922.2  CG3285-RA (CG3285), mRNA 
0   NM_130732.1  CG6428-RA (CG6428), mRNA 
0   NM_168468.1  CG32091-RB (CG32091), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001038952.1  CG33975-RA (CG33975), mRNA 
0   NM_139917.2  CG7927-RA (CG7927), mRNA 
0   NM_166653.1  CG3182-RB, transcript variant B (sei), mRNA 
0   NM_057365.3  CG3182-RA, transcript variant A (sei), mRNA 
0   NM_057941.3  CG5227-RA, transcript variant A (sdk), mRNA 
0   NM_134314.2  CG5227-RB, transcript variant B (sdk), mRNA 
0   NM_134315.2  CG5227-RD, transcript variant D (sdk), mRNA 
0   NM_057942.3  CG5227-RC, transcript variant C (sdk), mRNA 
0   NM_140015.2  CG5651-RA, transcript variant A (CG5651), mRNA 
0   NM_168306.1  CG5651-RB, transcript variant B (CG5651), mRNA 
0   NM_135073.2  CG17970-RA (Cyp4ac2), mRNA 
0   NM_132673.2  CG11178-RB, transcript variant B (CG11178), mRNA 
0   NM_167377.1  CG11178-RA, transcript variant A (CG11178), mRNA 
0   NM_001015101.1  CG12423-PB.3 (CG12423), mRNA 
0   NM_001015100.1  CG12423-PA.3 (CG12423), mRNA 
0   NM_057814.3  CG12244-RA (lic), mRNA 
0   NM_078503.3  CG3780-RA (Spx), mRNA 
0   NM_142497.2  CG18208-RA (CG18208), mRNA 
0   NM_164658.1  CG11147-RB, transcript variant B (CG11147), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.