National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3821R-3 
 Symbol Aats-asp  Full Name Aspartyl-tRNA synthetase 
 CG No CG3821  Old CG No CG3821 
 Synonyms CG3821, aats-asp, poney, l(2)49Db, l(2)k04508, AspRS, DRS, cDNA1, vr1, l(2)vr1, clone 2.49, anon-EST:Liang-2.49, l(2)v27, Aats-asp 
 Accession No (Link to NCBI) NM_057261.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Arsham AM, Neufeld TP.
A genetic screen in Drosophila reveals novel cytoprotective functions of the autophagy-lysosome pathway.
PLoS ONE (2009) 4(6) e6068 [ PubMed ID = 19562034 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGCCGCTAAGAAAGCCGAAC 
 Primer Seq. 3'
aatctagaggtaccACGCGATGCATCCTCGATTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGCCGCTAA GAAAGCCGAA CAAAAAGCGG AGAACGCCTC CACCGCGGCG GCCAATAACG 
0061 CTGGTGGCGA TTCTGCGGAG GATCACGCCG CCGGAAGATA TGGCCTCTCG GAAATGATCC 
0121 AATCCAAGGA CAAACGCAGT GANACGCAAC TTTGTCCCGG TTTCGGAACT AAGCGGTCAG 
0181 GTGGGCAAAG GACTGGTCTG GGTGCGAGGA CGCGTCCACA CTTCGAGAGC CAAGGGAAAG 
0241 CAGTGCTTCC TCATCCTGCG CCAGCAGAGC AGCACGGTGC AGTGCATCCT GGCTGTCGGT 
0301 GATGTTATCT CCAAACAGAT GGTCAAATTT GCGGGAAATA TCCCTAAGGA GAGCATTATT 
0361 GATATCCAGG CCAAGCCAGT GGCGGTGTCT AGCAAGATTG AATCCTGCAC AGAGCAGTCG 
0421 CTNGGAATTG TCCGTCGAGC AGATATTCGT AATATCCCAG GCCAAGGCAC AGTTGCCATT 
0481 GCAAATCGAG GATGCATCNC GT 
 in silico PCR Fragment
0001 AGGCCGCTAA GAAAGCCGAA CAAAAAGCGG AGAACGCCTC CACCGCGGCG GCCAATAACG 
0061 CTGGTGGCGA TTCTGCGGAG GATCACGCCG CCGGAAGATA TGGCCTCTCG GAAATGATCC 
0121 AATCCAAGGA CAAACGCAGT GA-ACGCAAC TTTGTCCCGG TTTCGGAACT AAGCGGTCAG 
0181 GTGGGCAAAG GACTGGTCTG GGTGCGAGGA CGCGTCCACA CTTCGAGAGC CAAGGGAAAG 
0241 CAGTGCTTCC TCATCCTGCG CCAGCAGAGC AGCACGGTGC AGTGCATCCT GGCTGTCGGT 
0301 GATGTTATCT CCAAACAGAT GGTCAAATTT GCGGGAAATA TCCCTAAGGA GAGCATTATT 
0361 GATATCCAGG CCAAGCCAGT GGCGGTGTCT AGCAAGATTG AATCCTGCAC AGAGCAGTCG 
0421 CT-GGAATTG TCCGTCGAGC AGATATTCGT AATATCCCAG GCCAAGGCAC AGTTGCCATT 
0481 GCAAATCGAG GATGCATCGC GT 
 Assemble Data

3821R-3.IR_full       1   AGGCCGCTAAGAAAGCCGAACAAAAAGCGGAGAACGCCTCCACCGCGGCGGCCAATAACG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3821R-3.in silico     1   AGGCCGCTAAGAAAGCCGAACAAAAAGCGGAGAACGCCTCCACCGCGGCGGCCAATAACG 60


3821R-3.IR_full       61  CTGGTGGCGATTCTGCGGAGGATCACGCCGCCGGAAGATATGGCCTCTCGGAAATGATCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3821R-3.in silico     61  CTGGTGGCGATTCTGCGGAGGATCACGCCGCCGGAAGATATGGCCTCTCGGAAATGATCC 120


3821R-3.IR_full       121 AATCCAAGGACAAACGCAGTGANACGCAACTTTGTCCCGGTTTCGGAACTAAGCGGTCAG 180
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
3821R-3.in silico     121 AATCCAAGGACAAACGCAGTGA-ACGCAACTTTGTCCCGGTTTCGGAACTAAGCGGTCAG 180


3821R-3.IR_full       181 GTGGGCAAAGGACTGGTCTGGGTGCGAGGACGCGTCCACACTTCGAGAGCCAAGGGAAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3821R-3.in silico     181 GTGGGCAAAGGACTGGTCTGGGTGCGAGGACGCGTCCACACTTCGAGAGCCAAGGGAAAG 240


3821R-3.IR_full       241 CAGTGCTTCCTCATCCTGCGCCAGCAGAGCAGCACGGTGCAGTGCATCCTGGCTGTCGGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3821R-3.in silico     241 CAGTGCTTCCTCATCCTGCGCCAGCAGAGCAGCACGGTGCAGTGCATCCTGGCTGTCGGT 300


3821R-3.IR_full       301 GATGTTATCTCCAAACAGATGGTCAAATTTGCGGGAAATATCCCTAAGGAGAGCATTATT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3821R-3.in silico     301 GATGTTATCTCCAAACAGATGGTCAAATTTGCGGGAAATATCCCTAAGGAGAGCATTATT 360


3821R-3.IR_full       361 GATATCCAGGCCAAGCCAGTGGCGGTGTCTAGCAAGATTGAATCCTGCACAGAGCAGTCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3821R-3.in silico     361 GATATCCAGGCCAAGCCAGTGGCGGTGTCTAGCAAGATTGAATCCTGCACAGAGCAGTCG 420


3821R-3.IR_full       421 CTNGGAATTGTCCGTCGAGCAGATATTCGTAATATCCCAGGCCAAGGCACAGTTGCCATT 480
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3821R-3.in silico     421 CT-GGAATTGTCCGTCGAGCAGATATTCGTAATATCCCAGGCCAAGGCACAGTTGCCATT 480


3821R-3.IR_full       481 GCAAATCGAGGATGCATCNCGT 502
                          |||||||||||||||||| |||
3821R-3.in silico     481 GCAAATCGAGGATGCATCGCGT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057261.2  CG3821-RA (Aats-asp), mRNA 
0   NM_144446.1  CG18869-RA (CG18869), mRNA 
0   NM_080004.2  CG18869-RA (CG18869), mRNA, ankyrin repeat, tyrosine kinase CG18247-RA (shark), mRNA 
0   NM_079797.2  CG6348-RA, transcript variant A (ro), mRNA 
0   NM_170294.1  CG6348-RB, transcript variant B (ro), mRNA 
0   NM_143496.3  CG15523-RA (CG15523), mRNA 
0   NM_166413.2  CG10052-RA (Rx), mRNA 
0   NM_137043.2  CG13333-RA (CG13333), mRNA 
0   NM_164316.2  CG31516-RA (CG31516), mRNA 
0   NM_001014460.2  CG7085-RD, transcript variant D (l(2)s5379), mRNA 
0   NM_134814.4  CG7085-RA, transcript variant A (l(2)s5379), mRNA 
0   NM_001032049.1  CG7085-RE, transcript variant E (l(2)s5379), mRNA 
0   NM_167927.1  CG1960-RB, transcript variant B (mu2), mRNA 
0   NM_079163.2  CG1960-RA, transcript variant A (mu2), mRNA 
0   NM_141273.2  CG16708-RB, transcript variant B (CG16708), mRNA 
0   NM_169050.1  CG16708-RA, transcript variant A (CG16708), mRNA 
0   NM_079491.2  CG5723-RB (Ten-m), mRNA 
0   NM_001043128.1  CG7422-RB (CG7422), mRNA 
0   NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
0   NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
0   NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
0   NM_130624.2  CG16903-RA (CG16903), mRNA 
0   NM_135247.2  CG9138-RA (SP1070), mRNA 
0   NM_139492.2  CG2103-RA, transcript variant A (pgant6), mRNA 
0   NM_167966.1  CG2103-RB, transcript variant B (pgant6), mRNA 
0   NM_139858.2  CG8564-RA (CG8564), mRNA 
0   NM_134789.1  CG15356-RA (CG15356), mRNA 
0   NM_058000.2  CG1982-RA (Sodh-1), mRNA 
0   NM_079587.2  CG4649-RA (Sodh-2), mRNA 
0   NM_132978.2  CG10598-RA, transcript variant A (CG10598), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.