National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3758R-1 
 Symbol esg  Full Name escargot 
 CG No CG3758  Old CG No CG3758 
 Synonyms CG3758, BG:DS07851.7, l(2)35Ce, l(2)br43, wiz, l(2)esg, l35Ce, dgl, 4B7, br43, shof, l(2)4B7, l(2)07082, flg, esg 
 Accession No (Link to NCBI) NM_057252.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Wu C, Li Z, Ding X, Guo X, Sun Y, Wang X, Hu Y, Li T, La X, Li J, Li JA, Li W, Xue L.
Snail modulates JNK-mediated cell death in Drosophila.
Cell Death Dis (2019) 10(12) 893 [ PubMed ID = 31772150 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGAAAATCCCTCCGAGGAACTGATCAACGTCAGCGATTGTTGCGAGGACGAGGGTGTGGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGTAGATCATACAGATGATGAACACATCGAGGAGGAGGACGAGGACGTCGATGTGGATGT 120

                          |||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||| silico     121 GGACTCGGACCCAAATCAGACCCAGGCTGCGGCTTTAGCTGCTGCCGCAGCTGTGGCCGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     181 CGCTGCAGCCGCCTCCGTGGTTGTGCCCACGCCCACATACCCGAAATATCCCTGGAACAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     241 CTTCCACATGTCGCCCTACACCGCCGAGTTCTACAGGACCATCAATCAGCAGGGTCATCA 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     301 GATTTTGCCGCTGCGTGGCGATCTCATTGCGCCCAGTTCGCCGAGTGAC-TCGCTGGGCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCCTGTCGCCGCCACCACATCATTACCTTCATGGTCGCGCAAGCTCCGTTTCCCCGCCCA 420

                          ||||||| ||||||||||||||||||||||||||||||||||||||  |||||||||||| silico     421 TGAGATCTGAAATCATCCATAGACCAATCGGCGTGCGGCAGCACCG--TTTCCTGCCCTA 480

                          ||||||||||||||||||||||   | silico     481 TCCACAGATGCCCGGTTATCCG---A 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_057252.3  CG3758-RA (esg), mRNA 
0.41   NM_139707.1  CG15214-RA (CG15214), mRNA 
0.41   10  NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0.2   NM_134738.2  CG4887-RA (CG4887), mRNA 
0.2   12  NM_078859.2  CG5813-RA, transcript variant A (chif), mRNA 
0.2   12  NM_165156.1  CG5813-RB, transcript variant B (chif), mRNA 
0.2   12  NM_142899.1  CG10152-RA (beat-IV), mRNA 
0.2   NM_132084.2  CG12219-RA (CG12219), mRNA 
0.2   14  NM_134962.2  CG31772-RA (CG31772), mRNA 
0.2   NM_139363.1  CG7852-RA, transcript variant A (CG7852), mRNA 
0.2   NM_206232.1  CG7852-RC, transcript variant C (CG7852), mRNA 
0.2   NM_167890.1  CG7852-RB, transcript variant B (CG7852), mRNA 
0.2   NM_135870.3  CG4218-RA (CG4218), mRNA 
0   23  149  189  NM_078751.3  CG3047-RA (Sgs1), mRNA 
0   20  83  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   22  83  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   15  13  NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   15  13  NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   15  13  NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   17  NM_165667.1  CG2040-RA, transcript variant A (hig), mRNA 
0   17  NM_165666.1  CG2040-RB, transcript variant B (hig), mRNA 
0   17  NM_001014514.1  CG2040-RD, transcript variant D (hig), mRNA 
0   17  NM_080371.2  CG2040-RC, transcript variant C (hig), mRNA 
0   13  12  NM_135112.1  CG11030-RA (CG11030), mRNA 
0   12  NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   12  NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   12  NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   12  NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   18  59  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   18  59  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.