National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3749R-2 
 Symbol Atf-2  Full Name Activating transcription factor-2 
 CG No CG30420  Old CG No CG3749 
 Synonyms CG30420, CG12850, CG3749, Atf-2, dATF-2 
 Accession No (Link to NCBI) NM_166690.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Terriente-Félix A, Pérez L, Bray SJ, Nebreda AR, Milán M.
A Drosophila model of myeloproliferative neoplasm reveals a feed-forward loop in the JAK pathway mediated by p38 MAPK signalling.
Dis Model Mech (2017) 10(4) 399-407 [ PubMed ID = 28237966 ] [ RRC reference ]

Clemente-Ruiz M, Murillo-Maldonado JM, Benhra N, Barrio L, Pérez L, Quiroga G, Nebreda AR, Milán M.
Gene Dosage Imbalance Contributes to Chromosomal Instability-Induced Tumorigenesis.
Dev. Cell (2016) 36(3) 290-302 [ PubMed ID = 26859353 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACTACGAGTCCAACGGAAAC 
 Primer Seq. 3'
aatctagaggtaccGGAATATTCACTCCCGCCACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NACTACGAGT CCAACGGAAA CAACCTGAAC CAGCAGTACG ACCAGTACGA CAACGCGGAG 
0061 GCAGAGGCCA GCTACGGCAG TNCCGATGGA GGCAGTCTCT GATCTCCAAA GTCCTCCATT 
0121 GTACCTCCCT CGCCTGCCCA ACCTACCACC CTTGCCCAGC CTTCCGAATC GGCCCAGCCT 
0181 GGGCAACTCC CCGAACAGGN AACAGTGTGC TCCGCGAACG GATTCCCTTT GCCGTAGGTN 
0241 CCAGCGACGC TCGCTTCTTT GACAACCCGA ANCGACCCTT CGGGGGAGCT GGATTCCCGG 
0301 GCGCTGGAGG ACTACGAGGA GTATGCTCCC ATTGAGCCTA CAACCGAAGT AGCCACCACC 
0361 GCCAGTAAGA CCAAGATCGA TACGCCAGTA CCGGCTCCCG TGCCCGTTGA GCCGCCCAAA 
0421 CTGCTTGACG NCGNCAACTA CCAACTTACC CACCGCTATC AATCNCTCAC NCAGTCCGCC 
0481 TGCCGCCGCA TGCCGTGGCG GGAGTGAATA TTCC 
 in silico PCR Fragment
0001 GACTACGAGT CCAACGGAAA CAACCTGAAC CAGCAGTACG ACCAGTACGA CAACGCGGAG 
0061 GCAGAGGCCA GCTACGGCAG T-CCGATGGA GGCAGTCTCT GATCTCCAAA GTCCTCCATT 
0121 GTACCTGCCT CGCCTGCCCA ACCTACCACC CTTGCCCAGC CTTCCGAATC GGCCCAGCCT 
0181 GGGCAACTCC CCGAACAGG- AACAGTGTGC TCCGCGAACG GATTCCCTTT GCTGTAGGTC 
0241 CCAGCGACGC TCGCTTCTTT GACAACCCGA A-CGACCCTT CGGGGGAGCT GGATTCCCGG 
0301 GCGCTGGAGG ACTACGAGGA GTATGCTCCC ATTGAGCCCA CAACCGAAGT AGCCACCACC 
0361 GCCAGTAAGA CCAAGATCGA TACGCCAGTA CCGGCTCCCG TGCCCGTTGA GCCGCCCAAA 
0421 CTGCTTGACG CCGCCAAC-A CCAACTT--C CACCGC-ATC AATC-----C CCAGTCCGCC 
0481 -GCCGCCGCA -GCCGTGGCG GGAGTGAATA TTCC 
 Assemble Data

3749R-2.IR_full        1   ACTACGAGTCCAACGGAAACAACCTGAACCAGCAGTACGACCAGTACGACAACGCGGAG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3749R-2.in silico      1   ACTACGAGTCCAACGGAAACAACCTGAACCAGCAGTACGACCAGTACGACAACGCGGAG 59


3749R-2.IR_full       61  GCAGAGGCCAGCTACGGCAGTNCCGATGGAGGCAGTCTCTGATCTCCAAAGTCCTCCATT 119
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
3749R-2.in silico     61  GCAGAGGCCAGCTACGGCAGT-CCGATGGAGGCAGTCTCTGATCTCCAAAGTCCTCCATT 119


3749R-2.IR_full       121 GTACCTCCCTCGCCTGCCCAACCTACCACCCTTGCCCAGCCTTCCGAATCGGCCCAGCCT 179
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
3749R-2.in silico     121 GTACCTGCCTCGCCTGCCCAACCTACCACCCTTGCCCAGCCTTCCGAATCGGCCCAGCCT 179


3749R-2.IR_full       181 GGGCAACTCCCCGAACAGGNAACAGTGTGCTCCGCGAACGGATTCCCTTTGCCGTAGGTN 239
                          ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| 
3749R-2.in silico     181 GGGCAACTCCCCGAACAGG-AACAGTGTGCTCCGCGAACGGATTCCCTTTGCTGTAGGTC 239


3749R-2.IR_full       241 CCAGCGACGCTCGCTTCTTTGACAACCCGAANCGACCCTTCGGGGGAGCTGGATTCCCGG 299
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
3749R-2.in silico     241 CCAGCGACGCTCGCTTCTTTGACAACCCGAA-CGACCCTTCGGGGGAGCTGGATTCCCGG 299


3749R-2.IR_full       301 GCGCTGGAGGACTACGAGGAGTATGCTCCCATTGAGCCTACAACCGAAGTAGCCACCACC 359
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
3749R-2.in silico     301 GCGCTGGAGGACTACGAGGAGTATGCTCCCATTGAGCCCACAACCGAAGTAGCCACCACC 359


3749R-2.IR_full       361 GCCAGTAAGACCAAGATCGATACGCCAGTACCGGCTCCCGTGCCCGTTGAGCCGCCCAAA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3749R-2.in silico     361 GCCAGTAAGACCAAGATCGATACGCCAGTACCGGCTCCCGTGCCCGTTGAGCCGCCCAAA 419


3749R-2.IR_full       421 CTGCTTGACGNCGNCAACTACCAACTTACCCACCGCTATCAATCNCTCACNCAGTCCGCC 479
                          |||||||||| || |||| ||||||||  ||||||| |||||||     | |||||||||
3749R-2.in silico     421 CTGCTTGACGCCGCCAAC-ACCAACTT--CCACCGC-ATCAATC-----CCCAGTCCGCC 479


3749R-2.IR_full       481 TGCCGCCGCATGCCGTGGCGGGAGTGAATATTCC 513
                           ||||||||| |||||||||||||||||||||||
3749R-2.in silico     481 -GCCGCCGCA-GCCGTGGCGGGAGTGAATATTCC 513

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166690.1  CG30420-RA, transcript variant A (Atf-2), mRNA 
100   482  NM_138130.2  CG30420-RB, transcript variant B (Atf-2), mRNA 
0   NM_132951.2  CG4928-RB, transcript variant B (CG4928), mRNA 
0   NM_167552.1  CG4928-RA, transcript variant A (CG4928), mRNA 
0   NM_169458.1  CG11502-RA, transcript variant A (svp), mRNA 
0   NM_169729.1  CG10388-RE, transcript variant E (Ubx), mRNA 
0   NM_169728.1  CG10388-RD, transcript variant D (Ubx), mRNA 
0   NM_080500.2  CG10388-RB, transcript variant B (Ubx), mRNA 
0   NM_080504.2  CG10388-RA, transcript variant A (Ubx), mRNA 
0   NM_169730.1  CG10388-RC, transcript variant C (Ubx), mRNA 
0   NM_206497.1  CG10388-RF, transcript variant F (Ubx), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 
0   22  45  NM_176712.1  CG33181-RA (CG33181), mRNA 
0   10  23  NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   26  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_167620.2  CG32547-RA (CG32547), mRNA 
0   NM_057385.4  CG11121-RA (so), mRNA 
0   17  NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   17  NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   17  NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   17  NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_132302.3  CG7055-RA (dalao), mRNA 
0   NM_137941.1  CG11079-RA, transcript variant A (CG11079), mRNA 
0   NM_166595.1  CG11079-RB, transcript variant B (CG11079), mRNA 
0   NM_169409.3  CG31363-RB, transcript variant B (Jupiter), mRNA 
0   NM_141567.1  CG9793-RA (CG9793), mRNA 
0   NM_057266.4  CG4162-RA (lace), mRNA 
0   11  NM_135595.2  CG17108-RA (CG17108), mRNA 
0   10  NM_169094.1  CG1093-RA, transcript variant A (plx), mRNA 
0   NM_169095.1  CG1093-RB, transcript variant B (plx), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.