National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3725R-2 
 Symbol Ca-P60A  Full Name Calcium ATPase at 60A 
 CG No CG3725  Old CG No CG3725 
 Synonyms SERCA, Ca-P60, CaP60A, dSERCA, Kum, CG3725, Ca-ATPase, sarco/endoplasmic reticulum-type Ca-2+-ATPase., l(2)k09025, CA-P60A, Ca[2+]ATPase, l(2)k08308ab, Ca-p, Ca-P60A 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jia D, Soylemez M, Calvin G, Bornmann R, Bryant J, Hanna C, Huang YC, Deng WM.
A large-scale in vivo RNAi screen to identify genes involved in Notch-mediated follicle cell differentiation and cell cycle switches.
Sci Rep (2015) 5 12328 [ PubMed ID = 26205122 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCATTGAGGCCCTCAAGGAGT 
 Primer Seq. 3'
aatctagaggtaccGTCGTTGAAGTGGCCGATGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCATTGAGGC CCTCAAGGAG TACGAGCCTG AGATGGGCAA GGTGGTGCGC CAGGACAAGT 
0061 CCGGCATCCA GAAGGTGCGC GCGAAAGAGA TCGTGCCCGG TGACCTGGTT GAGGTGTCTG 
0121 TCGGTGACAA GATCCCTGCC GATATCCGTA TCACCCACAT CTACTCGACC ACCCTTAGGA 
0181 TCGATCAGTC CATCCTCACC GGTGAGTCGG TCTCCGTCAT CAAGCACACC GATGCCATCC 
0241 CCGATCCCCG CGCCGTCAAC CAGGACAAGA AGAACATCCT GTTCTCCGGC ACCAACGTCG 
0301 CAGCCGGCAA AGCCCGCGGC GTCGTCATCG GCACTGGCCT AAGCACCGCC ATCGGCAAGA 
0361 TCCGTACTGA GATGTCCGAG ACCGAGGAGA TCAAGACCCC CCTGCAGCAG AAACTGGACG 
0421 AGTTCGGTGA GCAGCTGTCC AAGGTCATTT CCGTCATTTG CGTTGCCGTG TGGGCCATCA 
0481 ACATCGGCCA CTTCAACGAC  
 in silico PCR Fragment
0001 CCATTGAGGC CCTCAAGGAG TACGAGCCTG AGATGGGCAA GGTGGTGCGC CAGGACAAGT 
0061 CCGGCATCCA GAAGGTGCGC GCGAAAGAGA TCGTGCCCGG TGACCTGGTT GAGGTGTCTG 
0121 TCGGTGACAA GATCCCTGCC GATATCCGTA TCACCCACAT CTACTCGACC ACCCTTAGGA 
0181 TCGATCAGTC CATCCTCACC GGTGAGTCGG TCTCCGTCAT CAAGCACACC GATGCCATCC 
0241 CCGATCCCCG CGCCGTCAAC CAGGACAAGA AGAACATCCT GTTCTCCGGC ACCAACGTCG 
0301 CAGCCGGCAA GGCCCGTGGC GTCGTCATCG GCACTGGCCT GAGCACCGCC ATCGGCAAGA 
0361 TCCGTACTGA GATGTCCGAG ACCGAGGAGA TCAAGACCCC CCTGCAGCAG AAACTGGACG 
0421 AGTTCGGTGA GCAGCTGTCC AAGGTCATTT CCGTCATTTG CGTTGCCGTG TGGGCCATCA 
0481 ACATCGGCCA CTTCAACGAC  
 Assemble Data

3725R-2.IR full       1   CCATTGAGGCCCTCAAGGAGTACGAGCCTGAGATGGGCAAGGTGGTGCGCCAGGACAAGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3725R-2.in silico     1   CCATTGAGGCCCTCAAGGAGTACGAGCCTGAGATGGGCAAGGTGGTGCGCCAGGACAAGT 60


3725R-2.IR full       61  CCGGCATCCAGAAGGTGCGCGCGAAAGAGATCGTGCCCGGTGACCTGGTTGAGGTGTCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3725R-2.in silico     61  CCGGCATCCAGAAGGTGCGCGCGAAAGAGATCGTGCCCGGTGACCTGGTTGAGGTGTCTG 120


3725R-2.IR full       121 TCGGTGACAAGATCCCTGCCGATATCCGTATCACCCACATCTACTCGACCACCCTTAGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3725R-2.in silico     121 TCGGTGACAAGATCCCTGCCGATATCCGTATCACCCACATCTACTCGACCACCCTTAGGA 180


3725R-2.IR full       181 TCGATCAGTCCATCCTCACCGGTGAGTCGGTCTCCGTCATCAAGCACACCGATGCCATCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3725R-2.in silico     181 TCGATCAGTCCATCCTCACCGGTGAGTCGGTCTCCGTCATCAAGCACACCGATGCCATCC 240


3725R-2.IR full       241 CCGATCCCCGCGCCGTCAACCAGGACAAGAAGAACATCCTGTTCTCCGGCACCAACGTCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3725R-2.in silico     241 CCGATCCCCGCGCCGTCAACCAGGACAAGAAGAACATCCTGTTCTCCGGCACCAACGTCG 300


3725R-2.IR full       301 CAGCCGGCAAAGCCCGCGGCGTCGTCATCGGCACTGGCCTAAGCACCGCCATCGGCAAGA 360
                          |||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||
3725R-2.in silico     301 CAGCCGGCAAGGCCCGTGGCGTCGTCATCGGCACTGGCCTGAGCACCGCCATCGGCAAGA 360


3725R-2.IR full       361 TCCGTACTGAGATGTCCGAGACCGAGGAGATCAAGACCCCCCTGCAGCAGAAACTGGACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3725R-2.in silico     361 TCCGTACTGAGATGTCCGAGACCGAGGAGATCAAGACCCCCCTGCAGCAGAAACTGGACG 420


3725R-2.IR full       421 AGTTCGGTGAGCAGCTGTCCAAGGTCATTTCCGTCATTTGCGTTGCCGTGTGGGCCATCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3725R-2.in silico     421 AGTTCGGTGAGCAGCTGTCCAAGGTCATTTCCGTCATTTGCGTTGCCGTGTGGGCCATCA 480


3725R-2.IR full       481 ACATCGGCCACTTCAACGAC 500
                          ||||||||||||||||||||
3725R-2.in silico     481 ACATCGGCCACTTCAACGAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.