National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3722R-1 
 Symbol shg  Full Name shotgun 
 CG No CG3722  Old CG No CG3722 
 Synonyms E-cad, E-Cad, Ecad, DCAD2, DE-cadherin, DE-Cad, E-cadherin, DE-cad, Cad, Shg, CT12481, shg/DE-Cad, DE, DE[cyto], DE-CAD, CADH, DCad, DEC, l(2)k10220, l(2)k03401, DECad, D-cad, gp150, l(2)10469, CadE, CG3722, shg, DE-Cadherin, e-cad, DEcad, ECad 
 Accession No (Link to NCBI) NM_057374.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Curran S, Strandkvist C, Bathmann J, de Gennes M, Kabla A, Salbreux G, Baum B.
Myosin II Controls Junction Fluctuations to Guide Epithelial Tissue Ordering.
Dev. Cell (2017) [ PubMed ID = 29107560 ] [ RRC reference ]

Wang Y, Antunes M, Anderson AE, Kadrmas JL, Jacinto A, Galko MJ.
Integrin Adhesions Suppress Syncytium Formation in the Drosophila Larval Epidermis.
Curr. Biol. (2015) 25(17) 2215-27 [ PubMed ID = 26255846 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Campbell K, Casanova J, Skaer H.
Mesenchymal-to-epithelial transition of intercalating cells in Drosophila renal tubules depends on polarity cues from epithelial neighbours.
Mech. Dev. (2010) 127(7-8) 345-57 [ PubMed ID = 20382220 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Maeda K, Takemura M, Umemori M, Adachi-Yamada T.
E-cadherin prolongs the moment for interaction between intestinal stem cell and its progenitor cell to ensure Notch signaling in adult Drosophila midgut.
Genes Cells (2008) 13(12) 1219-27 [ PubMed ID = 19021776 ] [ RRC reference ]

Sasaki N, Sasamura T, Ishikawa HO, Kanai M, Ueda R, Saigo K, Matsuno K.
Polarized exocytosis and transcytosis of Notch during its apical localization in Drosophila epithelial cells.
Genes Cells (2007) 12(1) 89-103 [ PubMed ID = 17212657 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCAGAAGCTACCACTGCATCAATATGTCGGCGACCCCGCAGGCCGGCCACCTAAATCCCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCCAGCAACAGACGCACCAGCAGCACAAGCGAAAATGCCGCGACCTTGGCAGGCGACTAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCCCCGCGAGACTCCTCCTGGGCGTTATCGTGGCCATCAGCCTTCTGTCACCCGCCCTCG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CACTTCACTCGCCGCCGGACAAAAACTTTTCCGGCGACAATCGTAAGCCCGCCTTCAAAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACTGCGCCGGATACGCTCCTAAGGTCAAAGAGGAGCAGCCCGAAAACACCTACGTTCTCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCGTAGAGGCCGTCGACCCTGATCCCGACCAGGTCATTCGATACAGCATCGTCCAGTCGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGTTCGAGCGACCCAAGTTCTTTATCAATCCCAGCACGGGCGTAATCTTCACCACCCACA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CATTCGATCGTGACGAGCCGATCCACGAGAAGTTCGTCTTCGTCACCGTCCAGGCCACGG 480

3722R-1.IR_full       481 ATAATGGTCTGCCCCCACTTG 501
                          |||||||||||||||||| || silico     481 ATAATGGTCTGCCCCCAC-TG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057374.2  CG3722-RA (shg), mRNA 
0   19  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_078768.2  CG9554-RB, transcript variant B (eya), mRNA 
0   NM_164693.1  CG9554-RA, transcript variant A (eya), mRNA 
0   NM_167595.3  CG12348-RE, transcript variant E (Sh), mRNA 
0   NM_167594.2  CG12348-RC, transcript variant C (Sh), mRNA 
0   NM_133033.1  CG12672-RA (CG12672), mRNA 
0   NM_139560.2  CG14971-RA (CG14971), mRNA 
0   NM_168088.1  CG32249-RA (CG32249), mRNA 
0   NM_140447.1  CG9598-RA (CG9598), mRNA 
0   NM_206004.1  CG10719-RC, transcript variant C (brat), mRNA 
0   NM_134302.1  CG10719-RB, transcript variant B (brat), mRNA 
0   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 
0   NM_167194.1  CG3001-RB, transcript variant B (Hex-A), mRNA 
0   NM_080109.2  CG3001-RA, transcript variant A (Hex-A), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_164898.1  CG4916-RB, transcript variant B (me31B), mRNA 
0   NM_001014645.1  CG31156-RB, transcript variant B (CG31156), mRNA 
0   NM_078809.2  CG4916-RA, transcript variant A (me31B), mRNA 
0   NM_140091.2  CG6757-RA (SH3PX1), mRNA 
0   NM_142813.3  CG31156-RA, transcript variant A (CG31156), mRNA 
0   10  NM_132578.1  CG11146-RA (CG11146), mRNA 
0   NM_136941.2  CG8828-RA (CG8828), mRNA 
0   13  18  NM_058149.3  CG3352-RA (ft), mRNA 
0   10  17  NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   10  17  NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   22  NM_164981.1  CG18789-RA (CG18789), mRNA 
0   16  NM_144407.2  CG18787-RA (CG18787), mRNA 
0   11  NM_132206.1  CG2253-RA (Upf2), mRNA 
0   104  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.