National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3705R-1 
 Symbol aay  Full Name astray 
 CG No CG3705  Old CG No CG3705 
 Synonyms 0423/14, CG3705, anon-WO0172774.117, aay 
 Accession No (Link to NCBI) NM_079277.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     1   GCAGCCACAAATGGCCATAATCTGCTGACCAAACAGCTGAATTGCAATGGCAATGGCACC 60

                          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     61  ACCGGTGGCGCGGCGAAAACCACTGTGGCCTCGGCCATAACACCGCCCAAGCAGCCCCAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTGGCGGCCAAGGTCATCCAGCAGTCGCAGATCGTCTGTTTCGATGTGGACTCCACGGTG 180

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     181 ATTTGCGAGGAGGGCATCGACGAACTGGCCGAATATTGTGGCAAGGGGAGCGAGGTGGCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     241 CGCGTTACCAAGGAGGCGATGGGCGGTGCCATGACCTTCCAGGATGCCCTCAAAATTCGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTGAACATCATACGGCCGACACAGCAGCAAGTGAGGGATTTCATCCAGGAGCGACCCAGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     361 ACACTGAGCAAAAACGTGAAGCGTTTCGTCAGCCATTTGAAGGCGGAGGGAAAACAGGTT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TACTTGATCTCCGGCGGATTCGATTGCCTAATTGCGCCCGTGGCCAATGAATTGGGTATT 480

3705R-1.IR_full       481 CCCCTGAAAAACGTCTATGC 500
                          |||||||||||||||||||| silico     481 CCCCTGAAAAACGTCTATGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079277.2  CG3705-RA (aay), mRNA 
0   NM_001032403.1  CG7649-RB, transcript variant B (Neu3), mRNA 
0   NM_058150.2  CG2047-RA (ftz), mRNA 
0   NM_001032404.1  CG7649-RA, transcript variant A (Neu3), mRNA 
0   NM_140050.2  CG4022-RA (CG4022), mRNA 
0   NM_001043084.1  CG34123-RD, transcript variant D (CG34123), mRNA 
0   NM_001043083.1  CG34123-RB, transcript variant B (CG34123), mRNA 
0   NM_001043085.1  CG34123-RC, transcript variant C (CG34123), mRNA 
0   NM_144221.2  CG32636-RA (CG32636), mRNA 
0   10  NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   10  NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_142755.1  CG5732-RA (CG5732), mRNA 
0   NM_137194.1  CG8179-RA (CG8179), mRNA 
0   NM_139436.1  CG15822-RC (CG15822), mRNA 
0   NM_134932.2  CG2772-RA (CG2772), mRNA 
0   NM_143717.1  CG10840-RB (eIF5B), mRNA 
0   NM_132226.1  CG1583-RA (CG1583), mRNA 
0   NM_058049.4  CG6759-RA (cdc16), mRNA 
0   NM_137713.2  CG4266-RA (CG4266), mRNA 
0   NM_176723.2  CG33175-RG, transcript variant G (spri), mRNA 
0   NM_206678.1  CG33175-RA, transcript variant A (spri), mRNA 
0   NM_176724.1  CG33175-RH, transcript variant H (spri), mRNA 
0   NM_137943.2  CG3493-RA (CG3493), mRNA 
0   NM_165080.1  CG31771-RA (CG31771), mRNA 
0   NM_205953.1  CG4128-RE, transcript variant E (nAcRalpha-30D), mRNA 
0   NM_205952.1  CG4128-RD, transcript variant D (nAcRalpha-30D), mRNA 
0   NM_164874.2  CG4128-RA, transcript variant A (nAcRalpha-30D), mRNA 
0   NM_205951.1  CG4128-RB, transcript variant B (nAcRalpha-30D), mRNA 
0   NM_135472.4  CG4128-RC, transcript variant C (nAcRalpha-30D), mRNA 
0   NM_001038799.1  CG4128-RF, transcript variant F (nAcRalpha-30D), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.