National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3696R-1 
 Symbol kis  Full Name kismet 
 CG No CG3696  Old CG No CG3696 
 Synonyms kiss, CG3660, KIS, EK2-4, l(2)k16510, GM02209, 5841, 2532, 136/31, l(2)k14112, l(2)k13631, unnamed, l(2)k11324, l(2)s4793, l(2)s4771, l(2)s3527, l(2)k08827, l(2)07812, Su(Pc)21AB, CG18326, CG3696, BEST:GM02209, anon-WO0257455.5, anon-WO0172774.164, kis 
 Accession No (Link to NCBI) NM_164376.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Dubruille R, Murad A, Rosbash M, Emery P.
A constant light-genetic screen identifies KISMET as a regulator of circadian photoresponses.
PLoS Genet (2009) 5(12) e1000787 [ PubMed ID = 20041201 ] [ RRC reference ]

Terriente-Félix A, Molnar C, Gómez-Skarmeta JL, de Celis JF.
A conserved function of the chromatin ATPase Kismet in the regulation of hedgehog expression.
Dev Biol (2011) 350(2) 382-92 [ PubMed ID = 21146514 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TAAACCCATGGACTTCAGCAGCTTCTCGGCGTTCTGCGAGCATCTTAACAAATCTTCACA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AATTGCAGCAACAACTGCAACGACGATACCGCCAACAATAAACAATGGAAAAGGCATTTA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTTGGAGAAAATGGAGCGACAGGGAAAGATGGAACTGGCGGCGAAGGAGCGCGAGTCCCA 180

                          ||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     181 ACGGCTGCAGCTCATTCCCAAAAAATGGAACCGCCGGG-AAGAATACGAATTTCTTAGAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTCTTACCGGGTATGGTGTGGACCTACACGTCTCAACACCTATGGCTTCCTCTAATGGAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTTCCCTTTCGCCCGACTGGACCAAGTTCAAACAGATGGCTCACCTAGAGAGAAAAAGCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATGAAACACTGACGGACTATTATAAGGTATTTGTGGCCATGTGTAAACGACAGGCGGGTT 420

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TAAAGCTCTCTGAATCGGAGCGCGGCTTAGAAGGTATCATCGAAGAAATCGAAAAGGAAC 480

3696R-1.IR_full       481 ANGCCAAGCTCATACTGGATC 501
                          | ||||||||||||||||||| silico     481 ACGCCAAGCTCATACTGGATC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
73.65   355  12  NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_132573.1  CG17788-RA (CG17788), mRNA 
0   NM_078797.2  CG13109-RA (tai), mRNA 
0   NM_058098.2  CG10393-RA (amos), mRNA 
0   14  NM_137081.2  CG30483-RA (Prosap), mRNA 
0   NM_079764.2  CG6875-RA (asp), mRNA 
0   NM_168059.2  CG14995-RA, transcript variant A (CG14995), mRNA 
0   NM_168058.2  CG14995-RC, transcript variant C (CG14995), mRNA 
0   NM_168057.2  CG14995-RD, transcript variant D (CG14995), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_142180.2  CG4285-RA (CG4285), mRNA 
0   NM_135227.1  CG11322-RA (CG11322), mRNA 
0   NM_078955.2  CG3454-RA (Hdc), mRNA 
0   NM_206321.1  CG7590-RB, transcript variant B (scyl), mRNA 
0   NM_001015396.1  CG40411-PC.3 (CG40411), mRNA 
0   NM_001015395.1  CG40411-PE.3 (CG40411), mRNA 
0   NM_168319.1  CG4760-RA, transcript variant A (bol), mRNA 
0   NM_168320.1  CG4760-RC, transcript variant C (bol), mRNA 
0   NM_132538.1  CG15737-RA (CG15737), mRNA 
0   NM_079369.2  CG7599-RA (Eig71Ef), mRNA 
0   NM_001015188.1  CG40178-PB.3 (CG40178), mRNA 
0   NM_001015189.1  CG40178-PC.3 (CG40178), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   10  NM_135783.2  CG16820-RA (CG16820), mRNA 
0   NM_169252.1  CG11984-RA, transcript variant A (CG11984), mRNA 
0   NM_169253.1  CG11984-RC, transcript variant C (CG11984), mRNA 
0   NM_141604.2  CG11984-RB, transcript variant B (CG11984), mRNA 
0   NM_132328.1  CG17446-RA (CG17446), mRNA 
0   NM_080313.2  CG9659-RC, transcript variant C (egh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.