National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3696R-1 
 Symbol kis  Full Name kismet 
 CG No CG3696  Old CG No CG3696 
 Synonyms kiss, CG3660, KIS, EK2-4, l(2)k16510, GM02209, 5841, 2532, 136/31, l(2)k14112, l(2)k13631, unnamed, l(2)k11324, l(2)s4793, l(2)s4771, l(2)s3527, l(2)k08827, l(2)07812, Su(Pc)21AB, CG18326, CG3696, BEST:GM02209, anon-WO0257455.5, anon-WO0172774.164, kis 
 Accession No (Link to NCBI) NM_164376.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dubruille R, Murad A, Rosbash M, Emery P.
A constant light-genetic screen identifies KISMET as a regulator of circadian photoresponses.
PLoS Genet. (2009) 5(12) e1000787 [ PubMed ID = 20041201 ] [ RRC reference ]

Terriente-Félix A, Molnar C, Gómez-Skarmeta JL, de Celis JF.
A conserved function of the chromatin ATPase Kismet in the regulation of hedgehog expression.
Dev. Biol. (2011) 350(2) 382-92 [ PubMed ID = 21146514 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAAACCCATGGACTTCAGCAG 
 Primer Seq. 3'
aatctagaggtaccGATCCAGTATGAGCTTGGCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TAAACCCATG GACTTCAGCA GCTTCTCGGC GTTCTGCGAG CATCTTAACA AATCTTCACA 
0061 AATTGCAGCA ACAACTGCAA CGACGATACC GCCAACAATA AACAATGGAA AAGGCATTTA 
0121 TTTGGAGAAA ATGGAGCGAC AGGGAAAGAT GGAACTGGCG GCGAAGGAGC GCGAGTCCCA 
0181 ACGTCTGCAG CTCATTCCCA AAAAATGGAA CCGCCGGGNA AGAATACGAA TTTCTTAGAG 
0241 TTCTTACCGG GTATGGTGTG GACCTACACG TCTCAACACC TATGGCTTCC TCTAATGGAA 
0301 GTTCCCTTTC GCCCGACTGG ACCAAGTTCA AACAGATGGC TCACCTAGAG AGAAAAAGCG 
0361 ATGAAACACT GACGGACTAT TATAAGGTAT TTGTGGCCAT GTGTAAACGA CAGGCGGGTT 
0421 TAAAGCTCTC TGAATCGGAG CGCGGCTTAG AAGGTATCAT CGAAGAAATC GAAAAGGAAN 
0481 ANGCCAAGCT CATACTGGAT C 
 in silico PCR Fragment
0001 TAAACCCATG GACTTCAGCA GCTTCTCGGC GTTCTGCGAG CATCTTAACA AATCTTCACA 
0061 AATTGCAGCA ACAACTGCAA CGACGATACC GCCAACAATA AACAATGGAA AAGGCATTTA 
0121 TTTGGAGAAA ATGGAGCGAC AGGGAAAGAT GGAACTGGCG GCGAAGGAGC GCGAGTCCCA 
0181 ACGGCTGCAG CTCATTCCCA AAAAATGGAA CCGCCGGG-A AGAATACGAA TTTCTTAGAG 
0241 TTCTTACCGG GTATGGTGTG GACCTACACG TCTCAACACC TATGGCTTCC TCTAATGGAA 
0301 GTTCCCTTTC GCCCGACTGG ACCAAGTTCA AACAGATGGC TCACCTAGAG AGAAAAAGCG 
0361 ATGAAACACT GACGGACTAT TATAAGGTAT TTGTGGCCAT GTGTAAACGA CAGGCGGGTT 
0421 TAAAGCTCTC TGAATCGGAG CGCGGCTTAG AAGGTATCAT CGAAGAAATC GAAAAGGAAC 
0481 ACGCCAAGCT CATACTGGAT C 
 Assemble Data

3696R-1.IR_full       1   TAAACCCATGGACTTCAGCAGCTTCTCGGCGTTCTGCGAGCATCTTAACAAATCTTCACA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3696R-1.in silico     1   TAAACCCATGGACTTCAGCAGCTTCTCGGCGTTCTGCGAGCATCTTAACAAATCTTCACA 60


3696R-1.IR_full       61  AATTGCAGCAACAACTGCAACGACGATACCGCCAACAATAAACAATGGAAAAGGCATTTA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3696R-1.in silico     61  AATTGCAGCAACAACTGCAACGACGATACCGCCAACAATAAACAATGGAAAAGGCATTTA 120


3696R-1.IR_full       121 TTTGGAGAAAATGGAGCGACAGGGAAAGATGGAACTGGCGGCGAAGGAGCGCGAGTCCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3696R-1.in silico     121 TTTGGAGAAAATGGAGCGACAGGGAAAGATGGAACTGGCGGCGAAGGAGCGCGAGTCCCA 180


3696R-1.IR_full       181 ACGTCTGCAGCTCATTCCCAAAAAATGGAACCGCCGGGNAAGAATACGAATTTCTTAGAG 240
                          ||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||
3696R-1.in silico     181 ACGGCTGCAGCTCATTCCCAAAAAATGGAACCGCCGGG-AAGAATACGAATTTCTTAGAG 240


3696R-1.IR_full       241 TTCTTACCGGGTATGGTGTGGACCTACACGTCTCAACACCTATGGCTTCCTCTAATGGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3696R-1.in silico     241 TTCTTACCGGGTATGGTGTGGACCTACACGTCTCAACACCTATGGCTTCCTCTAATGGAA 300


3696R-1.IR_full       301 GTTCCCTTTCGCCCGACTGGACCAAGTTCAAACAGATGGCTCACCTAGAGAGAAAAAGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3696R-1.in silico     301 GTTCCCTTTCGCCCGACTGGACCAAGTTCAAACAGATGGCTCACCTAGAGAGAAAAAGCG 360


3696R-1.IR_full       361 ATGAAACACTGACGGACTATTATAAGGTATTTGTGGCCATGTGTAAACGACAGGCGGGTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3696R-1.in silico     361 ATGAAACACTGACGGACTATTATAAGGTATTTGTGGCCATGTGTAAACGACAGGCGGGTT 420


3696R-1.IR_full       421 TAAAGCTCTCTGAATCGGAGCGCGGCTTAGAAGGTATCATCGAAGAAATCGAAAAGGAAN 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
3696R-1.in silico     421 TAAAGCTCTCTGAATCGGAGCGCGGCTTAGAAGGTATCATCGAAGAAATCGAAAAGGAAC 480


3696R-1.IR_full       481 ANGCCAAGCTCATACTGGATC 501
                          | |||||||||||||||||||
3696R-1.in silico     481 ACGCCAAGCTCATACTGGATC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
73.65   355  12  NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_132573.1  CG17788-RA (CG17788), mRNA 
0   NM_078797.2  CG13109-RA (tai), mRNA 
0   NM_058098.2  CG10393-RA (amos), mRNA 
0   14  NM_137081.2  CG30483-RA (Prosap), mRNA 
0   NM_079764.2  CG6875-RA (asp), mRNA 
0   NM_168059.2  CG14995-RA, transcript variant A (CG14995), mRNA 
0   NM_168058.2  CG14995-RC, transcript variant C (CG14995), mRNA 
0   NM_168057.2  CG14995-RD, transcript variant D (CG14995), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_142180.2  CG4285-RA (CG4285), mRNA 
0   NM_135227.1  CG11322-RA (CG11322), mRNA 
0   NM_078955.2  CG3454-RA (Hdc), mRNA 
0   NM_206321.1  CG7590-RB, transcript variant B (scyl), mRNA 
0   NM_001015396.1  CG40411-PC.3 (CG40411), mRNA 
0   NM_001015395.1  CG40411-PE.3 (CG40411), mRNA 
0   NM_168319.1  CG4760-RA, transcript variant A (bol), mRNA 
0   NM_168320.1  CG4760-RC, transcript variant C (bol), mRNA 
0   NM_132538.1  CG15737-RA (CG15737), mRNA 
0   NM_079369.2  CG7599-RA (Eig71Ef), mRNA 
0   NM_001015188.1  CG40178-PB.3 (CG40178), mRNA 
0   NM_001015189.1  CG40178-PC.3 (CG40178), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   10  NM_135783.2  CG16820-RA (CG16820), mRNA 
0   NM_169252.1  CG11984-RA, transcript variant A (CG11984), mRNA 
0   NM_169253.1  CG11984-RC, transcript variant C (CG11984), mRNA 
0   NM_141604.2  CG11984-RB, transcript variant B (CG11984), mRNA 
0   NM_132328.1  CG17446-RA (CG17446), mRNA 
0   NM_080313.2  CG9659-RC, transcript variant C (egh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.