National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3658R-2 
 Symbol CDC45L  Full Name CDC45L 
 CG No CG3658  Old CG No CG3658 
 Synonyms Cdc45, CDC45, CG3658, EG:BACR7A4.11, DmCdc45, D, anon-1Ec, CDC45L 
 Accession No (Link to NCBI) NM_130524.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kondo S, Perrimon N.
A genome-wide RNAi screen identifies core components of the G₂-M DNA damage checkpoint.
Sci Signal (2011) 4(154) rs1 [ PubMed ID = 21205937 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCTGGTTGGCAAGCGCATC 
 Primer Seq. 3'
aatctagaggtaccCGCTCCAGGCGACTGAGCTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCTGGTTG GCAAGCGCAT CTTGATCGTG GTCAACTACG ACATCGATGC CATCTGCGCC 
0061 AGTCTGCATC CTGCAGGCCT TGTTCAAGTA CGATCACATG CTGTACACCG TGGTGCCCAT 
0121 AATGGGCGTT ACGGGTCTGA AGCGGGCCTA TGGAGAGCAC CAGGGCGACG TTAAGTACGT 
0181 GGTGTTGGTG AACTGCGGCG GCTGTGTAGA TATTGTGGAG CTCCTGCAGC CGTCGGACGA 
0241 CGTGNACCTT CTTCATATGC GATTCACATC GCCCGTTGGA TGTGTGTAAC ATCTACAGCG 
0301 ATCGGCAGGT GTGCATCTTG GGGGATGCCT CCTTGGAGGA GAATATTCCA GCGTTCGAGA 
0361 CAATTTTCTA TGACTCTGAA GGTGAAGACG AGGATGAGGA CGAGTCCTCT GACACGGAAC 
0421 AGCAGCACGA CGACAGTGGT GCCGGGGAAT CGGACCAGGA GGATCAGGCG CCAAGGAGCC 
0481 GTAAGCTCAG TCGCCTGNNG CG 
 in silico PCR Fragment
0001 CAGCTGGTTG GCAAGCGCAT CTTGATCGTG GTCAACTACG ACATCGATGC CATCTGCGCC 
0061 AGTC-GCATC CTGCAGGCCT TGTTCAAGTA CGATCACATG CTGTACACCG TGGTGCCCAT 
0121 AATGGGCGTT ACGGGTCTGA AGCGGGCCTA TGGAGAGCAC CAGGGCGACG TTAAGTACGT 
0181 GGTGTTGGTG AACTGCGGCG GCTGTGTAGA TATTGTGGAG CTCCTGCAGC CGTCGGACGA 
0241 CGTG-ACCTT CTTCATATGC GATTCACATC GCCCGTTGGA TGTGTGTAAC ATCTACAGCG 
0301 ATCGGCAGGT GTGCATCTTG GGGGATGCCT CCTTGGAGGA GAATATTCCA GCGTTCGAGA 
0361 CAATTTTCTA TGACTCTGAA GGTGAAGACG AGGATGAGGA CGAGTCCTCT GACACGGAAC 
0421 AGCAGCACGA CGACAGTGGT GCCGGGGAAT CGGACCAGGA GGATCAGGCG CCAAGGAGCC 
0481 GTAAGCTCAG TCGCCTGGAG CG 
 Assemble Data

3658R-2.IR_full       1   CAGCTGGTTGGCAAGCGCATCTTGATCGTGGTCAACTACGACATCGATGCCATCTGCGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3658R-2.in silico     1   CAGCTGGTTGGCAAGCGCATCTTGATCGTGGTCAACTACGACATCGATGCCATCTGCGCC 60


3658R-2.IR_full       61  AGTCTGCATCCTGCAGGCCTTGTTCAAGTACGATCACATGCTGTACACCGTGGTGCCCAT 120
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
3658R-2.in silico     61  AGTC-GCATCCTGCAGGCCTTGTTCAAGTACGATCACATGCTGTACACCGTGGTGCCCAT 120


3658R-2.IR_full       121 AATGGGCGTTACGGGTCTGAAGCGGGCCTATGGAGAGCACCAGGGCGACGTTAAGTACGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3658R-2.in silico     121 AATGGGCGTTACGGGTCTGAAGCGGGCCTATGGAGAGCACCAGGGCGACGTTAAGTACGT 180


3658R-2.IR_full       181 GGTGTTGGTGAACTGCGGCGGCTGTGTAGATATTGTGGAGCTCCTGCAGCCGTCGGACGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3658R-2.in silico     181 GGTGTTGGTGAACTGCGGCGGCTGTGTAGATATTGTGGAGCTCCTGCAGCCGTCGGACGA 240


3658R-2.IR_full       241 CGTGNACCTTCTTCATATGCGATTCACATCGCCCGTTGGATGTGTGTAACATCTACAGCG 300
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
3658R-2.in silico     241 CGTG-ACCTTCTTCATATGCGATTCACATCGCCCGTTGGATGTGTGTAACATCTACAGCG 300


3658R-2.IR_full       301 ATCGGCAGGTGTGCATCTTGGGGGATGCCTCCTTGGAGGAGAATATTCCAGCGTTCGAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3658R-2.in silico     301 ATCGGCAGGTGTGCATCTTGGGGGATGCCTCCTTGGAGGAGAATATTCCAGCGTTCGAGA 360


3658R-2.IR_full       361 CAATTTTCTATGACTCTGAAGGTGAAGACGAGGATGAGGACGAGTCCTCTGACACGGAAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3658R-2.in silico     361 CAATTTTCTATGACTCTGAAGGTGAAGACGAGGATGAGGACGAGTCCTCTGACACGGAAC 420


3658R-2.IR_full       421 AGCAGCACGACGACAGTGGTGCCGGGGAATCGGACCAGGAGGATCAGGCGCCAAGGAGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3658R-2.in silico     421 AGCAGCACGACGACAGTGGTGCCGGGGAATCGGACCAGGAGGATCAGGCGCCAAGGAGCC 480


3658R-2.IR_full       481 GTAAGCTCAGTCGCCTGNNGCG 502
                          |||||||||||||||||  |||
3658R-2.in silico     481 GTAAGCTCAGTCGCCTGGAGCG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130524.2  CG3658-RA (CDC45L), mRNA 
0.62   NM_165880.1  CG8841-RC, transcript variant C (CG8841), mRNA 
0.62   NM_136916.2  CG8841-RA, transcript variant A (CG8841), mRNA 
0.62   NM_165879.1  CG8841-RB, transcript variant B (CG8841), mRNA 
0.41   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 
0.41   NM_134302.1  CG10719-RB, transcript variant B (brat), mRNA 
0.41   NM_206004.1  CG10719-RC, transcript variant C (brat), mRNA 
0   14  NM_142457.2  CG7669-RA (CG7669), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_136942.2  CG8545-RA (CG8545), mRNA 
0   NM_057556.3  CG4088-RA, transcript variant A (lat), mRNA 
0   NM_165971.1  CG4088-RB, transcript variant B (lat), mRNA 
0   NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   10  NM_136611.2  CG8070-RA (Mys45A), mRNA 
0   NM_167015.2  CG6998-RC, transcript variant C (ctp), mRNA 
0   NM_080336.3  CG6998-RA, transcript variant A (ctp), mRNA 
0   NM_167016.1  CG6998-RD, transcript variant D (ctp), mRNA 
0   NM_167014.1  CG6998-RB, transcript variant B (ctp), mRNA 
0   NM_168660.1  CG4753-RA, transcript variant A (CG4753), mRNA 
0   NM_140630.2  CG4753-RB, transcript variant B (CG4753), mRNA 
0   NM_079100.2  CG17632-RA (bw), mRNA 
0   NM_144472.2  CG1898-RA (HBS1), mRNA 
0   11  NM_166246.1  CG6424-RA, transcript variant A (CG6424), mRNA 
0   11  NM_137405.2  CG6424-RB, transcript variant B (CG6424), mRNA 
0   NM_136972.2  CG12488-RA (CG12488), mRNA 
0   NM_141785.1  CG4706-RA (CG4706), mRNA 
0   15  NM_140532.2  CG7372-RA (CG7372), mRNA 
0   NM_164647.1  CG7269-RB, transcript variant B (Hel25E), mRNA 
0   NM_164648.1  CG7269-RC, transcript variant C (Hel25E), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.