National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3546R-1 
 Symbol CG3546  Full Name CG3546 
 CG No CG3546  Old CG No CG3546 
 Synonyms CG3546 
 Accession No (Link to NCBI) NM_131944.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGGAGAGACCATGATCGAG 
 Primer Seq. 3'
aatctagaggtaccGCATTGGCGACCACACTGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTGGAGAGA CCATGATCGA GGTGGACGAG AATGGCGATG AGTACGAGCT GAAACGATTC 
0061 TACATTCAGG GTCGCCAACT CAAGGGCGAT GGCAGTCAGT CGCAGTGTGT GGTCACGAGA 
0121 AGGAAGCGTT CGGGTCGTGC AGCAGGATCT GGATCCGGAT CAGGATCGGC AGCCACTCTG 
0181 TCGGTTAGTT CGCAACCCCT GAAGGTGGAG AGTCTGCCCG CGAAGGAACA TCGTGAGGGA 
0241 GGAGCTGTTC TGCAGGAGGT GGAGAGCAAT AGCAATAGCA ATAGACGTTA TGTCGCCCTC 
0301 ACTGGAGTCC ACTTGGAGTC GCCTCTGCCC CAGGGTGATG TGCAGAACGA TGACAACGAC 
0361 GATGACGACG AGGAGGACGA TGATGGCGAC GATCAGTCTT CCAGAAATCA GTCCAACTTT 
0421 GTGCCCGCTG CCTTgGCTTT GCCCCTGCAG AGCCAGTCCA CTGCTGCCCA TCTGAATCAG 
0481 GGAGTCAGTG TGGTCGCCAA NGC 
 in silico PCR Fragment
0001 GCTGGAGAGA CCATGATCGA GGTGGACGAA AATGGCGATG AGTACGAGCT GAAGCGATTC 
0061 TATATTCAGG GTCGCCAATT GAAGGGCGAT GGCAGTCAGT CGCAGTGTGT GGTCACGAGA 
0121 AGGAAGCGTT CGGGTCGTGC AGCAGGATCT GGATCAGGAT CAGGATCGGC AG---CTCTG 
0181 TCGGTTAGTT CGCAACCCCT GAAGGTGGAG AGTCTGCCGG CGAAGGAACA TCGTGAGGGA 
0241 GGAGCTGTTC TGCAGGAGGT GGAGAGCAAT AGCAATAGCA ATAGACGTTA TGTCGCCCTC 
0301 ACTGGAGTCC ACTTGGAGTC GCCTCTGCCC CAGGGTGATG TGCAGAACGA TGACAACGAC 
0361 GATGACGACG AGGAGGACGA TGATGGCGAC GATCAGTCTT CCAGAAATCA GTCCAACTTT 
0421 GTGCCCGCTG CCTTGGCTTT GCCCCTGCAA AGCCAGTCCA CTGCTGCCCA TCTGAATCAG 
0481 GGAGTCAGTG TGGTCGCCAA TGC 
 Assemble Data

3546R-1.IR_full       1   GCTGGAGAGACCATGATCGAGGTGGACGAGAATGGCGATGAGTACGAGCTGAAACGATTC 60
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||
3546R-1.in silico     1   GCTGGAGAGACCATGATCGAGGTGGACGAAAATGGCGATGAGTACGAGCTGAAGCGATTC 60


3546R-1.IR_full       61  TACATTCAGGGTCGCCAACTCAAGGGCGATGGCAGTCAGTCGCAGTGTGTGGTCACGAGA 120
                          || ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||
3546R-1.in silico     61  TATATTCAGGGTCGCCAATTGAAGGGCGATGGCAGTCAGTCGCAGTGTGTGGTCACGAGA 120


3546R-1.IR_full       121 AGGAAGCGTTCGGGTCGTGCAGCAGGATCTGGATCCGGATCAGGATCGGCAGCCACTCTG 180
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||   |||||
3546R-1.in silico     121 AGGAAGCGTTCGGGTCGTGCAGCAGGATCTGGATCAGGATCAGGATCGGCAG---CTCTG 180


3546R-1.IR_full       181 TCGGTTAGTTCGCAACCCCTGAAGGTGGAGAGTCTGCCCGCGAAGGAACATCGTGAGGGA 240
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
3546R-1.in silico     181 TCGGTTAGTTCGCAACCCCTGAAGGTGGAGAGTCTGCCGGCGAAGGAACATCGTGAGGGA 240


3546R-1.IR_full       241 GGAGCTGTTCTGCAGGAGGTGGAGAGCAATAGCAATAGCAATAGACGTTATGTCGCCCTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3546R-1.in silico     241 GGAGCTGTTCTGCAGGAGGTGGAGAGCAATAGCAATAGCAATAGACGTTATGTCGCCCTC 300


3546R-1.IR_full       301 ACTGGAGTCCACTTGGAGTCGCCTCTGCCCCAGGGTGATGTGCAGAACGATGACAACGAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3546R-1.in silico     301 ACTGGAGTCCACTTGGAGTCGCCTCTGCCCCAGGGTGATGTGCAGAACGATGACAACGAC 360


3546R-1.IR_full       361 GATGACGACGAGGAGGACGATGATGGCGACGATCAGTCTTCCAGAAATCAGTCCAACTTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3546R-1.in silico     361 GATGACGACGAGGAGGACGATGATGGCGACGATCAGTCTTCCAGAAATCAGTCCAACTTT 420


3546R-1.IR_full       421 GTGCCCGCTGCCTTGGCTTTGCCCCTGCAGAGCCAGTCCACTGCTGCCCATCTGAATCAG 480
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
3546R-1.in silico     421 GTGCCCGCTGCCTTGGCTTTGCCCCTGCAAAGCCAGTCCACTGCTGCCCATCTGAATCAG 480


3546R-1.IR_full       481 GGAGTCAGTGTGGTCGCCAANGC 503
                          |||||||||||||||||||| ||
3546R-1.in silico     481 GGAGTCAGTGTGGTCGCCAATGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  54  NM_131944.1  CG3546-RA (CG3546), mRNA 
1.45   43  NM_131924.2  CG4857-RB (CG4857), mRNA 
0.62   26  111  NM_132831.1  CG8184-RB (CG8184), mRNA 
0.41   12  11  NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
0.41   12  11  NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0.41   12  11  NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
0.41   12  11  NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
0.2   43  NM_167022.1  CG32771-RA (CG32771), mRNA 
0.2   10  22  NM_164671.1  CG9088-RB, transcript variant B (lid), mRNA 
0.2   10  22  NM_078762.4  CG9088-RA, transcript variant A (lid), mRNA 
0.2   23  NM_079289.2  CG10574-RA (I-2), mRNA 
0.2   14  NM_079805.2  CG5954-RA, transcript variant A (l(3)mbt), mRNA 
0.2   14  NM_170330.1  CG5954-RB, transcript variant B (l(3)mbt), mRNA 
0.2   13  24  NM_001043220.1  CG34127-RA (CG34127), mRNA 
0.2   NM_142144.2  CG3731-RB, transcript variant B (CG3731), mRNA 
0.2   NM_169607.1  CG3731-RA, transcript variant A (CG3731), mRNA 
0.2   NM_169343.2  CG31147-RA (mthl11), mRNA 
0   31  39  41  NM_206723.1  CG8260-RB, transcript variant B (CG8260), mRNA 
0   31  39  34  NM_132841.1  CG8260-RA, transcript variant A (CG8260), mRNA 
0   10  14  NM_132141.1  CG14431-RA (CG14431), mRNA 
0   24  28  NM_134474.4  CG32532-RA (CG32532), mRNA 
0   24  62  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   24  45  NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 
0   18  15  NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   18  15  NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   13  38  NM_001038858.1  CG8585-RB, transcript variant B (Ih), mRNA 
0   13  38  NM_001038856.1  CG8585-RC, transcript variant C (Ih), mRNA 
0   13  38  NM_001038859.1  CG8585-RE, transcript variant E (Ih), mRNA 
0   43  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   16  47  NM_132429.2  CG2202-RA (CG2202), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.