National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3510R-1 
 Symbol CycB  Full Name Cyclin B 
 CG No CG3510  Old CG No CG3510 
 Synonyms cycB, cyclinB, DmcycB, CG3510, cyc B, mAbF2F4, 2g, cyc-B, CycB 
 Accession No (Link to NCBI) NM_166555.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Qian W, Li Z, Song W, Zhao T, Wang W, Peng J, Wei L, Xia Q, Cheng D.
A novel transcriptional cascade is involved in Fzr-mediated endoreplication.
Nucleic Acids Res. (2020) [ PubMed ID = 32182338 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGAGAACGCTTCGGAGAAC 
 Primer Seq. 3'
aatctagaggtaccCGTCGAATTCCTGAAACTCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATGAGAACG CTTCGGAGAA CTTCAAGCAA GTGCAATTGA AGAAATTGAC GGTTCCTTCC 
0061 ATGGAGGCAA CAACAAAACG CGCGGCCTTG GGCGATTTGC AGAATCGCGG CATAAGTCGT 
0121 CCCATCGCAG CGAAGGATGC GGCACAGAAA GACTCCAAGG ATCTCAAGCT CACANGACGC 
0181 CCTGCGCAAT GCCAAAGCTC GGGTGGACAG CCACTGGAAG AAACAGCCAC TGGGCAGCAC 
0241 CAATGGCAAT GGCAATGGCG CCGTTCCGCC CAAGGTCAAC GAGGGGGGCG TGTCGGCGTT 
0301 TTTGCGTTCG AATTCGGTGC GCAATCGCGT TCCGACCAAG ACCACTGTAG AACCCACTAA 
0361 AGTTACAGTC AAGTCCAGTT CTTCCGAGAA CGTGAACGAG CCCACCTTAA AGCGCGAGGA 
0421 CAGCAATCTG TCGAAGAAGT CGCTGACCAA NACTGCGTGC CGCTTTGGCC AAACCCGTGA 
0481 TGGGAGTTTC AGGAATTCGA CG 
 in silico PCR Fragment
0001 GATGAGAACG CTTCGGAGAA CTTCAAGCAA GTGCAATTGA AGAAATTGAC GGTTCCTTCC 
0061 ATGGAGGCAA CAACAAAACG CGCGGCCTTG GGCGATTTGC AGAATCGCGG CATAAGTCGT 
0121 CCCATCGCAG CGAAGGATGC GGCACAGAAA GACTCCAAGG ATCTCAAGCT CACA-GACGC 
0181 CCTGCGCAAT GCCAAAGCTC GGGTGGACAG CCACTGGAAG AAACAGCCAC TGGGCAGCAC 
0241 CAATGGCAAT GGCAATGGCG CCGTTCCGCC CAAGGTCAAC GAGGGGGGCG TGTCGGCGTT 
0301 TTTGCGTTCG AATTCGGTGC GCAATCGCGT TCCGACCAAG ACCACTGTAG AACCCACTAA 
0361 AGTTACAGTC AAGTCCAGTT CTTCCGAGAA CGTGAACGAG CCCACCTTAA AGCGCGAGGA 
0421 CAGCAATCTG TCGAAGAAGT CGCTGACCAA -ACTGCGTGC CGCTTTGGCC AAACCCGTGA 
0481 TGGGAGTTTC AGGAATTCGA CG 
 Assemble Data

3510R-1.IR_full       1   GATGAGAACGCTTCGGAGAACTTCAAGCAAGTGCAATTGAAGAAATTGACGGTTCCTTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3510R-1.in silico     1   GATGAGAACGCTTCGGAGAACTTCAAGCAAGTGCAATTGAAGAAATTGACGGTTCCTTCC 60


3510R-1.IR_full       61  ATGGAGGCAACAACAAAACGCGCGGCCTTGGGCGATTTGCAGAATCGCGGCATAAGTCGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3510R-1.in silico     61  ATGGAGGCAACAACAAAACGCGCGGCCTTGGGCGATTTGCAGAATCGCGGCATAAGTCGT 120


3510R-1.IR_full       121 CCCATCGCAGCGAAGGATGCGGCACAGAAAGACTCCAAGGATCTCAAGCTCACANGACGC 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
3510R-1.in silico     121 CCCATCGCAGCGAAGGATGCGGCACAGAAAGACTCCAAGGATCTCAAGCTCACA-GACGC 180


3510R-1.IR_full       181 CCTGCGCAATGCCAAAGCTCGGGTGGACAGCCACTGGAAGAAACAGCCACTGGGCAGCAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3510R-1.in silico     181 CCTGCGCAATGCCAAAGCTCGGGTGGACAGCCACTGGAAGAAACAGCCACTGGGCAGCAC 240


3510R-1.IR_full       241 CAATGGCAATGGCAATGGCGCCGTTCCGCCCAAGGTCAACGAGGGGGGCGTGTCGGCGTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3510R-1.in silico     241 CAATGGCAATGGCAATGGCGCCGTTCCGCCCAAGGTCAACGAGGGGGGCGTGTCGGCGTT 300


3510R-1.IR_full       301 TTTGCGTTCGAATTCGGTGCGCAATCGCGTTCCGACCAAGACCACTGTAGAACCCACTAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3510R-1.in silico     301 TTTGCGTTCGAATTCGGTGCGCAATCGCGTTCCGACCAAGACCACTGTAGAACCCACTAA 360


3510R-1.IR_full       361 AGTTACAGTCAAGTCCAGTTCTTCCGAGAACGTGAACGAGCCCACCTTAAAGCGCGAGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3510R-1.in silico     361 AGTTACAGTCAAGTCCAGTTCTTCCGAGAACGTGAACGAGCCCACCTTAAAGCGCGAGGA 420


3510R-1.IR_full       421 CAGCAATCTGTCGAAGAAGTCGCTGACCAANACTGCGTGCCGCTTTGGCCAAACCCGTGA 480
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
3510R-1.in silico     421 CAGCAATCTGTCGAAGAAGTCGCTGACCAA-ACTGCGTGCCGCTTTGGCCAAACCCGTGA 480


3510R-1.IR_full       481 TGGGAGTTTCAGGAATTCGACG 502
                          ||||||||||||||||||||||
3510R-1.in silico     481 TGGGAGTTTCAGGAATTCGACG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166555.1  CG3510-RA, transcript variant A (CycB), mRNA 
100   482  NM_166556.1  CG3510-RD, transcript variant D (CycB), mRNA 
99.17   478  NM_166557.1  CG3510-RB, transcript variant B (CycB), mRNA 
99.17   478  NM_166558.1  CG3510-RC, transcript variant C (CycB), mRNA 
0.41   NM_140634.1  CG4680-RA (CG4680), mRNA 
0.41   NM_141151.2  CG11370-RA (CG11370), mRNA 
0.2   NM_166668.1  CG4356-RA, transcript variant A (mAcR-60C), mRNA 
0.2   NM_079120.2  CG4356-RB, transcript variant B (mAcR-60C), mRNA 
0.2   NM_206678.1  CG33175-RA, transcript variant A (spri), mRNA 
0.2   NM_176723.2  CG33175-RG, transcript variant G (spri), mRNA 
0.2   NM_176724.1  CG33175-RH, transcript variant H (spri), mRNA 
0.2   NM_165699.1  CG1623-RB, transcript variant B (CG1623), mRNA 
0.2   NM_165700.1  CG1623-RD, transcript variant D (CG1623), mRNA 
0.2   NM_165698.1  CG1623-RA, transcript variant A (CG1623), mRNA 
0.2   NM_136676.2  CG1623-RC, transcript variant C (CG1623), mRNA 
0.2   NM_165701.1  CG1623-RE, transcript variant E (CG1623), mRNA 
0.2   NM_137194.1  CG8179-RA (CG8179), mRNA 
0   NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
0   NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
0   NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
0   NM_057511.3  CG3936-RA (N), mRNA 
0   NM_142105.1  CG14842-RA (CG14842), mRNA 
0   NM_134763.1  CG14351-RA (CG14351), mRNA 
0   NM_131968.2  CG32772-RA (CG32772), mRNA 
0   NM_137825.1  CG11301-RA (Mes4), mRNA 
0   12  12  NM_136857.2  CG12443-RA (ths), mRNA 
0   12  NM_141280.2  CG14669-RA (CG14669), mRNA 
0   13  NM_165493.1  CG15236-RB, transcript variant B (CG15236), mRNA 
0   13  NM_136397.1  CG15236-RA, transcript variant A (CG15236), mRNA 
0   10  NM_165049.1  CG31814-RA (CG31814), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.