National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3497R-1 
 Symbol Su(H)  Full Name Suppressor of Hairless 
 CG No CG3497  Old CG No CG3497 
 Synonyms SU(H), SuH, Su(h), FTZ-F2, oss, dRBP-JK, l(2)br7, dRBP-Jk, BG:DS00929.10, l(2)35Bh, su(H), l(2)k07904, RBP-J[[Kappa]], br7, C, dRBP-J[[Kappa]], l(1)br7, RBP-Jkappa, E(H), anon-WO0257455.3, D, CG3497, Su(H), RBP-J kappa, CBF1, SUH 
 Accession No (Link to NCBI) NM_057520.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zhao S, Wu C, Gao Z, Li X, Zheng G, Wang Z.
Notch signaling governs the expression of glypican Dally to define the stem cell niche.
Biol Open (2019) [ PubMed ID = 31826854 ] [ RRC reference ]

Casso DJ, Biehs B, Kornberg TB.
A novel interaction between hedgehog and Notch promotes proliferation at the anterior-posterior organizer of the Drosophila wing.
Genetics (2011) 187(2) 485-99 [ PubMed ID = 21098717 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACCGGCCACACATCGAGGAG 
 Primer Seq. 3'
aatctagaggtaccGCTACATTGGTGCCGCTGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACCGGCCAC ACATCGAGGA GAAGAAGCTC ACGCGGGACG CCATGGAGAA GTANCATGCG 
0061 CNAGCGCAAC GACATGGTCA TCGTTATCCT GCACGCCAAG GTGGCCCAAA AGTCCTATGG 
0121 CAATGAGAAG CGATTCTTTT GCCCACCGCC GTGCATTTAT CTGTTCGGAN AGTGGCTGGC 
0181 GCCGGCGGTN ACGAGGAGAT GTTGCAGCAG GGCGANGGGC GNAACAGGGA GCACAACTAT 
0241 GCGCGTTCAT CGGAATCGGG AGCAGTGATC AGGATATGCA GCAGCTGGAT CTCAATGGCA 
0301 AGCAGTACTG TGCGGCCAAG ACGCTCTTCA TCTCGGACTC GGACAAGCGA AAACACTTTA 
0361 TGCTGTCGGT GAAGATGTTT TACGGAAATG GTCATGACAT TGGCGTTTTT AACTCGAAAC 
0421 GGATCAAGGT TATATCCAAG CCGTCCAAAA AGAAACAGTC GCTAAAGAAT GCCGATCTGT 
0481 GCANTAGCCA GCGGCACCAA TGTAGC 
 in silico PCR Fragment
0001 TACCGGCCAC ACATCGAGGA GAAGAAGCTC ACGCGGGACG CCATGGAGAA GTA-CATGCG 
0061 CGAGCGCAAC GACATGGTCA TCGTTATCCT GCACGCCAAG GTGGCCCAAA AGTCCTATGG 
0121 CAATGAGAAG CGATTCTTTT GCCCACCGCC GTGCATTTAT CTGTTCGGA- AGTGGCTGGC 
0181 GCCGGCGGT- ACGAGGAGAT GTTGCAGCAG GGCGA-GGGC G-AACAGGGA GCACAACTAT 
0241 GCGCGTTCAT CGGTATCGGG AGCAGTGACC AGGATATGCA GCAGCTGGAT CTCAATGGCA 
0301 AGCAGTACTG TGCGGCCAAG ACGCTCTTCA TCTCGGACTC GGACAAGCGA AAACACTTTA 
0361 TGCTGTCGGT GAAGATGTTT TACGGAAACG GTCATGACAT TGGCGTTTTT AACTCGAAAC 
0421 GGATCAAGGT TATATCCAAG CCGTCCAAAA AGAAACAGTC GCTAAAGAAT GCCGATCTGT 
0481 GCA-TAGCCA GCGGCACCAA TGTAGC 
 Assemble Data

3497R-1.IR_full       1   TACCGGCCACACATCGAGGAGAAGAAGCTCACGCGGGACGCCATGGAGAAGTANCATGCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
3497R-1.in silico     1   TACCGGCCACACATCGAGGAGAAGAAGCTCACGCGGGACGCCATGGAGAAGTA-CATGCG 60


3497R-1.IR_full       61  CNAGCGCAACGACATGGTCATCGTTATCCTGCACGCCAAGGTGGCCCAAAAGTCCTATGG 120
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3497R-1.in silico     61  CGAGCGCAACGACATGGTCATCGTTATCCTGCACGCCAAGGTGGCCCAAAAGTCCTATGG 120


3497R-1.IR_full       121 CAATGAGAAGCGATTCTTTTGCCCACCGCCGTGCATTTATCTGTTCGGANAGTGGCTGGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
3497R-1.in silico     121 CAATGAGAAGCGATTCTTTTGCCCACCGCCGTGCATTTATCTGTTCGGA-AGTGGCTGGC 180


3497R-1.IR_full       181 GCCGGCGGTNACGAGGAGATGTTGCAGCAGGGCGANGGGCGNAACAGGGAGCACAACTAT 240
                          ||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||
3497R-1.in silico     181 GCCGGCGGT-ACGAGGAGATGTTGCAGCAGGGCGA-GGGCG-AACAGGGAGCACAACTAT 240


3497R-1.IR_full       241 GCGCGTTCATCGGAATCGGGAGCAGTGATCAGGATATGCAGCAGCTGGATCTCAATGGCA 300
                          ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
3497R-1.in silico     241 GCGCGTTCATCGGTATCGGGAGCAGTGACCAGGATATGCAGCAGCTGGATCTCAATGGCA 300


3497R-1.IR_full       301 AGCAGTACTGTGCGGCCAAGACGCTCTTCATCTCGGACTCGGACAAGCGAAAACACTTTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3497R-1.in silico     301 AGCAGTACTGTGCGGCCAAGACGCTCTTCATCTCGGACTCGGACAAGCGAAAACACTTTA 360


3497R-1.IR_full       361 TGCTGTCGGTGAAGATGTTTTACGGAAATGGTCATGACATTGGCGTTTTTAACTCGAAAC 420
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
3497R-1.in silico     361 TGCTGTCGGTGAAGATGTTTTACGGAAACGGTCATGACATTGGCGTTTTTAACTCGAAAC 420


3497R-1.IR_full       421 GGATCAAGGTTATATCCAAGCCGTCCAAAAAGAAACAGTCGCTAAAGAATGCCGATCTGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3497R-1.in silico     421 GGATCAAGGTTATATCCAAGCCGTCCAAAAAGAAACAGTCGCTAAAGAATGCCGATCTGT 480


3497R-1.IR_full       481 GCANTAGCCAGCGGCACCAATGTAGC 506
                          ||| ||||||||||||||||||||||
3497R-1.in silico     481 GCA-TAGCCAGCGGCACCAATGTAGC 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057520.3  CG3497-RA (Su(H)), mRNA 
0   NM_140501.2  CG7011-RA (CG7011), mRNA 
0   NM_079046.2  CG6542-RA, transcript variant A (EDTP), mRNA 
0   NM_206151.1  CG6542-RB, transcript variant B (EDTP), mRNA 
0   NM_079293.2  CG8091-RA (Nc), mRNA 
0   NM_205895.1  CG3057-RC, transcript variant C (colt), mRNA 
0   NM_205896.1  CG3057-RB, transcript variant B (colt), mRNA 
0   NM_205894.1  CG3057-RD, transcript variant D (colt), mRNA 
0   NM_057873.4  CG3057-RA, transcript variant A (colt), mRNA 
0   NM_137649.2  CG30147-RA, transcript variant A (Hil), mRNA 
0   NM_166402.1  CG30147-RB, transcript variant B (Hil), mRNA 
0   NM_057245.2  CG6189-RA (l(1)1Bi), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_170277.1  CG5462-RC, transcript variant C (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_144022.2  CG32428-RA (CG32428), mRNA 
0   NM_137755.2  CG15675-RA, transcript variant A (CG15675), mRNA 
0   NM_166527.1  CG5820-RA, transcript variant A (Gp150), mRNA 
0   NM_166528.1  CG5820-RB, transcript variant B (Gp150), mRNA 
0   NM_079624.3  CG14360-RA (Or88a), mRNA 
0   NM_166529.1  CG5820-RC, transcript variant C (Gp150), mRNA 
0   NM_057701.3  CG5820-RD, transcript variant D (Gp150), mRNA 
0   NM_078831.1  CG5006-RA (Or33c), mRNA 
0   NM_137163.3  CG10255-RA (Lap1), mRNA 
0   NM_176458.2  CG4509-RB (CG4509), mRNA 
0   NM_166042.1  CG8485-RC, transcript variant C (CG8485), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.