National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3394R-2 
 Symbol CG3394  Full Name CG3394 
 CG No CG3394  Old CG No CG3394 
 Synonyms CG3394 
 Accession No (Link to NCBI) NM_166666.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Fan W, Lam SM, Xin J, Yang X, Liu Z, Liu Y, Wang Y, Shui G, Huang X.
Drosophila TRF2 and TAF9 regulate lipid droplet size and phospholipid fatty acid composition.
PLoS Genet (2017) 13(3) e1006664 [ PubMed ID = 28273089 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGCAGAAGCTGGCCACCCGA 
 Primer Seq. 3'
aatctagaggtaccAGAGACTCCCCGCGCAGATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGCAGAAGC TGGCCACCCG ACTAGGCACC ATCCTGCTGG CCACAGTGAT CTTCGGCGCC 
0061 TTTTGCTGGG ACAACGCGTT GGCCAGTCTA ACACTGGGAG CAGTGGTGGC TCTCCTGCTA 
0121 AGAAATCCCA CCTTCGTCTT TGCCTTGGTA ATGACCGCGT CCAGGGACCT AAAAGGCTTT 
0181 CCAGCGATTC GTGGCCCTCA ACATCTACCT GCTAAGAAAG GATCGCGGCG GATTCACTGT 
0241 GGCCCGCTGT TTCCAGGACC AGGCCANGAC GCCGCCCCAA GAAGACATGC TTCGTGATGG 
0301 ACGATCGCCA TTTAAGCTTT GCAGAGGCTC TGGAGTTTAG CCAAAAGATA GCTGGATATT 
0361 TTAGCGATCG CGGCCTGGAG AGGGGCGACT GTGTGGCCCT ACTAATGGAA ACGCGTCTGG 
0421 AGTATCCCTG CATTTGGTTG GGTCTCTCCC AGCTCGGGGT AATCACAGCC CTTATTAACT 
0481 CCAATCTGCG CGGGGAGTCT CT 
 in silico PCR Fragment
0001 AAGCAGAAGC TGGCCACCCG ACTAGGCACC ATCCTGCTGG CCACAGTGAT CTTCGGCGCC 
0061 TTTTGCTGGG ACAACGCGTT GGCCAGTCTA ACACTGGGAG CAGTGGTGGC TCTCCTGCTC 
0121 AGAAATCCCA CCTTCGTCTT TGCCTTGGTA ATGACCGCGT CCAGGGACCT -AAAGGCTTT 
0181 CCAGCGATTC GTGGCCCTCA ACATCTACCT GCTAAGAAAG GATCGCGGCG GATTCACTGT 
0241 GGCCCGCTGT TTCCAGGACC AGGCCA-GAC GCCGCCCCAA AAAGACATGC TTCGTGATGG 
0301 ACGATCGCCA TTTAAGCTTT GCAGAGGCTC TGGAGTTTAG CCAAAAGATA GCTGGATATT 
0361 TTAGCGATCG CGGCCTGGAG AGGGGCGACT GTGTGGCCCT ACTAATGGAA ACGCGTCTGG 
0421 AGTATCCCTG CATTTGGTTG GGTCTCTCCC AGCTCGGGGT AATCACAGCC CTTATTAACT 
0481 CCAATCTGCG CGGGGAGTCT CT 
 Assemble Data

3394R-2.IR_full       1   AAGCAGAAGCTGGCCACCCGACTAGGCACCATCCTGCTGGCCACAGTGATCTTCGGCGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3394R-2.in silico     1   AAGCAGAAGCTGGCCACCCGACTAGGCACCATCCTGCTGGCCACAGTGATCTTCGGCGCC 60


3394R-2.IR_full       61  TTTTGCTGGGACAACGCGTTGGCCAGTCTAACACTGGGAGCAGTGGTGGCTCTCCTGCTA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
3394R-2.in silico     61  TTTTGCTGGGACAACGCGTTGGCCAGTCTAACACTGGGAGCAGTGGTGGCTCTCCTGCTC 120


3394R-2.IR_full       121 AGAAATCCCACCTTCGTCTTTGCCTTGGTAATGACCGCGTCCAGGGACCTAAAAGGCTTT 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
3394R-2.in silico     121 AGAAATCCCACCTTCGTCTTTGCCTTGGTAATGACCGCGTCCAGGGACCT-AAAGGCTTT 180


3394R-2.IR_full       181 CCAGCGATTCGTGGCCCTCAACATCTACCTGCTAAGAAAGGATCGCGGCGGATTCACTGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3394R-2.in silico     181 CCAGCGATTCGTGGCCCTCAACATCTACCTGCTAAGAAAGGATCGCGGCGGATTCACTGT 240


3394R-2.IR_full       241 GGCCCGCTGTTTCCAGGACCAGGCCANGACGCCGCCCCAAGAAGACATGCTTCGTGATGG 300
                          |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||
3394R-2.in silico     241 GGCCCGCTGTTTCCAGGACCAGGCCA-GACGCCGCCCCAAAAAGACATGCTTCGTGATGG 300


3394R-2.IR_full       301 ACGATCGCCATTTAAGCTTTGCAGAGGCTCTGGAGTTTAGCCAAAAGATAGCTGGATATT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3394R-2.in silico     301 ACGATCGCCATTTAAGCTTTGCAGAGGCTCTGGAGTTTAGCCAAAAGATAGCTGGATATT 360


3394R-2.IR_full       361 TTAGCGATCGCGGCCTGGAGAGGGGCGACTGTGTGGCCCTACTAATGGAAACGCGTCTGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3394R-2.in silico     361 TTAGCGATCGCGGCCTGGAGAGGGGCGACTGTGTGGCCCTACTAATGGAAACGCGTCTGG 420


3394R-2.IR_full       421 AGTATCCCTGCATTTGGTTGGGTCTCTCCCAGCTCGGGGTAATCACAGCCCTTATTAACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3394R-2.in silico     421 AGTATCCCTGCATTTGGTTGGGTCTCTCCCAGCTCGGGGTAATCACAGCCCTTATTAACT 480


3394R-2.IR_full       481 CCAATCTGCGCGGGGAGTCTCT 502
                          ||||||||||||||||||||||
3394R-2.in silico     481 CCAATCTGCGCGGGGAGTCTCT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166666.1  CG3394-RA, transcript variant A (CG3394), mRNA 
100   482  NM_138062.2  CG3394-RB, transcript variant B (CG3394), mRNA 
0   NM_139719.2  CG10592-RA (CG10592), mRNA 
0   NM_137443.2  CG10912-RA (CG10912), mRNA 
0   NM_141890.2  CG31358-RA (CG31358), mRNA 
0   NM_169672.1  CG4699-RB, transcript variant B (CG4699), mRNA 
0   NM_142235.1  CG4699-RA, transcript variant A (CG4699), mRNA 
0   NM_169673.1  CG4699-RC, transcript variant C (CG4699), mRNA 
0   NM_206420.1  CG33291-RA (CG33291), mRNA 
0   NM_137046.3  CG6191-RA (CG6191), mRNA 
0   NM_135178.2  CG9507-RA (CG9507), mRNA 
0   NM_142301.1  CG14889-RA (CG14889), mRNA 
0   NM_137219.2  CG8256-RC, transcript variant C (l(2)k05713), mRNA 
0   NM_166119.1  CG8256-RB, transcript variant B (l(2)k05713), mRNA 
0   NM_166118.1  CG8256-RA, transcript variant A (l(2)k05713), mRNA 
0   NM_140907.1  CG17732-RA (CG17732), mRNA 
0   NM_141000.1  CG3698-RA (CG3698), mRNA 
0   NM_134825.3  CG9967-RA, transcript variant A (CG9967), mRNA 
0   NM_001014461.1  CG9967-RB, transcript variant B (CG9967), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_001043282.1  CG4467-RB, transcript variant B (CG4467), mRNA 
0   NM_166639.1  CG3725-RH, transcript variant H (Ca-P60A), mRNA 
0   NM_169248.2  CG10901-RA, transcript variant A (osk), mRNA 
0   NM_142876.3  CG4467-RA, transcript variant A (CG4467), mRNA 
0   NM_206464.1  CG10901-RC, transcript variant C (osk), mRNA 
0   NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   NM_001031865.1  CG33950-RB, transcript variant B (trol), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_080522.2  CG9748-RA (bel), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.