National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3350R-1 
 Symbol bigmax  Full Name bigmax 
 CG No CG3350  Old CG No CG3350 
 Synonyms CG3350, DmMlx, BIGMAX, bigmax, Bigmax 
 Accession No (Link to NCBI) NM_143299.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Buchon N, Osman D, David FP, Fang HY, Boquete JP, Deplancke B, Lemaitre B.
Morphological and molecular characterization of adult midgut compartmentalization in Drosophila.
Cell Rep (2013) 3(5) 1725-38 [ PubMed ID = 23643535 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATAACAACGCGTTGGCCACCA 
 Primer Seq. 3'
aatctagaggtaccCCTGGATTCGCCTGCTGATGC 
 Predicted Fragment Size
490 
 IR fragment full Seq
0001 ATAACAACGC GTTGGCCACC AAGGAAGACG TTTTCGGCAT GGAGCACGAC CAGGACCACA 
0061 CCAGCAAGCA CTACTCGCGG TGCAGCAGTG CGGNGCAGCA CGCACACTCC GAACTCCTCG 
0121 GCGCACAATT CAGACGACGA CGACGATAGC GGCGATGcGC GCCATNTCCG CGGCCGCCAA 
0181 TTCCACGCTG AGTTACAAGG AGCGGAGAAG GGAGGCGCAC ACCCAGGCGG AGCAGAAAGC 
0241 GGCgNGATGC CATCAAGAAG GGCTACGACA GTCTGCAGGA GCTGGTTGCC GCGCTGCCAG 
0301 CCCAACGACT CCTCCGGCTA CAAGCTCAGC AAGGCTCTGA TCCTGCAGAA GTCCATCGAA 
0361 TACATTGGCT ACCTTAACCA GCAGAAACTC AAGCAGGAGG ACGAGGGATC GGCGCTACAG 
0421 AAGGAGGTAA CAGCGTTACG GATCATTAAG AACGGCTATG AGAACATGCT ACAGCATCAG 
0481 CAGGCGAATC CAGG 
 in silico PCR Fragment
0001 ATAACAACGC GTTGGCCACC AAGGAAGACG TTTTCGGCAT GGAGCACGAC CAGGACCACA 
0061 CCAGCAAGCA CTACTCGCGG TGCAGCAGTG CGG-GCAGCA CGCACACTCC GAACTCCTCG 
0121 GCGCACAATT CAGACGACGA CGACGATAGC GGCGATGCGC GCCAT-TCCG CGGCCGCCAA 
0181 TTCCACGCTG AGTTACAAGG AGCGGAGAAG GGAGGCGCAC ACCCAGGCGG AGCAG-AAGC 
0241 GGCGCGATGC CATTAAGAAG GGCTACGACA GTCTGCAGGA GCTGG-TGCC GCGCTGCCAG 
0301 CCCAACGACT CCTCCGGCTA CAAGCTCAGC AAGGCTCTGA TCCTGCAGAA GTCCATCGAA 
0361 TACATTGGCT ACCTTAACCA GCAGAAACTC AAGCAGGAGG ACGAGGGATC GGCGCTACAA 
0421 AAGGAGGTAA CAGCGTTACG GATCATTAAG AACGGCTATG AGAACATGCT ACAGCATCAG 
0481 CAGGCGAATC CAGG 
 Assemble Data

3350R-1.IR_full       1   ATAACAACGCGTTGGCCACCAAGGAAGACGTTTTCGGCATGGAGCACGACCAGGACCACA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3350R-1.in silico     1   ATAACAACGCGTTGGCCACCAAGGAAGACGTTTTCGGCATGGAGCACGACCAGGACCACA 60


3350R-1.IR_full       61  CCAGCAAGCACTACTCGCGGTGCAGCAGTGCGGNGCAGCACGCACACTCCGAACTCCTCG 120
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
3350R-1.in silico     61  CCAGCAAGCACTACTCGCGGTGCAGCAGTGCGG-GCAGCACGCACACTCCGAACTCCTCG 120


3350R-1.IR_full       121 GCGCACAATTCAGACGACGACGACGATAGCGGCGATGCGCGCCATNTCCGCGGCCGCCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
3350R-1.in silico     121 GCGCACAATTCAGACGACGACGACGATAGCGGCGATGCGCGCCAT-TCCGCGGCCGCCAA 180


3350R-1.IR_full       181 TTCCACGCTGAGTTACAAGGAGCGGAGAAGGGAGGCGCACACCCAGGCGGAGCAGAAAGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
3350R-1.in silico     181 TTCCACGCTGAGTTACAAGGAGCGGAGAAGGGAGGCGCACACCCAGGCGGAGCAG-AAGC 240


3350R-1.IR_full       241 GGCGNGATGCCATCAAGAAGGGCTACGACAGTCTGCAGGAGCTGGTTGCCGCGCTGCCAG 300
                          |||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||
3350R-1.in silico     241 GGCGCGATGCCATTAAGAAGGGCTACGACAGTCTGCAGGAGCTGG-TGCCGCGCTGCCAG 300


3350R-1.IR_full       301 CCCAACGACTCCTCCGGCTACAAGCTCAGCAAGGCTCTGATCCTGCAGAAGTCCATCGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3350R-1.in silico     301 CCCAACGACTCCTCCGGCTACAAGCTCAGCAAGGCTCTGATCCTGCAGAAGTCCATCGAA 360


3350R-1.IR_full       361 TACATTGGCTACCTTAACCAGCAGAAACTCAAGCAGGAGGACGAGGGATCGGCGCTACAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
3350R-1.in silico     361 TACATTGGCTACCTTAACCAGCAGAAACTCAAGCAGGAGGACGAGGGATCGGCGCTACAA 420


3350R-1.IR_full       421 AAGGAGGTAACAGCGTTACGGATCATTAAGAACGGCTATGAGAACATGCTACAGCATCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3350R-1.in silico     421 AAGGAGGTAACAGCGTTACGGATCATTAAGAACGGCTATGAGAACATGCTACAGCATCAG 480


3350R-1.IR_full       481 CAGGCGAATCCAGG 494
                          ||||||||||||||
3350R-1.in silico     481 CAGGCGAATCCAGG 494

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_143299.2  CG3350-RA (bigmax), mRNA 
0   NM_164867.1  CG31710-RA (CG31710), mRNA 
0   13  NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   13  NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   13  NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_166072.1  CG10205-RA, transcript variant A (CG10205), mRNA 
0   NM_141976.3  CG10134-RA (beat-Va), mRNA 
0   NM_136368.2  CG17994-RA (CG17994), mRNA 
0   NM_001014589.1  CG33522-RA, transcript variant A (scaf6), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_166055.1  CG10108-RA (phyl), mRNA 
0   11  10  NM_168640.1  CG5942-RD, transcript variant D (brm), mRNA 
0   11  10  NM_080497.4  CG5942-RC, transcript variant C (brm), mRNA 
0   11  10  NM_168641.1  CG5942-RB, transcript variant B (brm), mRNA 
0   11  10  NM_080498.2  CG5942-RA, transcript variant A (brm), mRNA 
0   NM_169357.1  CG31390-RA (MED7), mRNA 
0   NM_169929.1  CG17838-RF, transcript variant F (CG17838), mRNA 
0   NM_169927.1  CG17838-RA, transcript variant A (CG17838), mRNA 
0   NM_169928.1  CG17838-RC, transcript variant C (CG17838), mRNA 
0   NM_142656.2  CG17838-RB, transcript variant B (CG17838), mRNA 
0   NM_169925.1  CG17838-RE, transcript variant E (CG17838), mRNA 
0   10  NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_079473.2  CG7758-RA (ppl), mRNA 
0   NM_130681.1  CG14424-RA (CG14424), mRNA 
0   NM_001043187.1  CG40049-RC, transcript variant C (mRpS5), mRNA 
0   NM_001043189.1  CG40049-RB, transcript variant B (mRpS5), mRNA 
0   NM_001043188.1  CG40049-RA, transcript variant A (mRpS5), mRNA 
0   NM_135079.4  CG14021-RB, transcript variant B (CG14021), mRNA 
0   NM_164640.1  CG14021-RA, transcript variant A (CG14021), mRNA 
0   NM_137193.1  CG12959-RA (CG12959), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.