National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32775R-3 
 Symbol GlcAT-I  Full Name GlcAT-I 
 CG No CG32775  Old CG No CG32775 
 Synonyms CG32775, BcDNA:GH05057, GlcAT-I 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCTGATGATGGTGCACCGA 
 Primer Seq. 3'
aatctagaggtaccATTTTGCTCATCTCGGCGAAC 
 Predicted Fragment Size
470 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

32775R-3.IR full       1   GTGCTGATGATGGTGCACCGAAACGGGAAGCGCACATGCCAGGGTCCAGAATACCTCCAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32775R-3.in silico     1   GTGCTGATGATGGTGCACCGAAACGGGAAGCGCACATGCCAGGGTCCAGAATACCTCCAG 60


32775R-3.IR full       61  GCCATGTTCGTCCAAGGCGACACGTTACCCACGATTTACGCCGTAACGCCAACGTATCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32775R-3.in silico     61  GCCATGTTCGTCCAAGGCGACACGTTACCCACGATTTACGCCGTAACGCCAACGTATCCA 120


32775R-3.IR full       121 CGGCCCGCCCAGAAAGCCGAGCTAACCAGACTATCTCACCTCTTTATGCTGCTGCCGCAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32775R-3.in silico     121 CGGCCCGCCCAGAAAGCCGAGCTAACCAGACTATCTCACCTCTTTATGCTGCTGCCGCAC 180


32775R-3.IR full       181 CTGCACTGGATCATTGTGGAGGACACGAACGCCACCACTCCGCTGGTCAGAAACCTTTTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32775R-3.in silico     181 CTGCACTGGATCATTGTGGAGGACACGAACGCCACCACTCCGCTGGTCAGAAACCTTTTG 240


32775R-3.IR full       241 GATAGAGCCGGATTGGAGAAGCGTTCCACGTTGCTGAACATCAAGACGCCATCTGAGTTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32775R-3.in silico     241 GATAGAGCCGGATTGGAGAAGCGTTCCACGTTGCTGAACATCAAGACGCCATCTGAGTTC 300


32775R-3.IR full       301 AAGCTGAAGGGCAAGGACCCCAACTGGATTAAGCCACGCGGCGTGGAGCAAAGAAATCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32775R-3.in silico     301 AAGCTGAAGGGCAAGGACCCCAACTGGATTAAGCCACGCGGCGTGGAGCAAAGAAATCTG 360


32775R-3.IR full       361 GCTTTGGCCTGGTTGAGGAACCATGTCGACGTCGATCGGCACTCTATAGTGTTCTTCATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32775R-3.in silico     361 GCTTTGGCCTGGTTGAGGAACCATGTCGACGTCGATCGGCACTCTATAGTGTTCTTCATG 420


32775R-3.IR full       421 GACGACGACAACTCCTACTCCACGGAACTGTTCGCCGAGATGAGCAAAAT 470
                           ||||||||||||||||||||||||||||||||||||||||||||||||||
32775R-3.in silico     421 GACGACGACAACTCCTACTCCACGGAACTGTTCGCCGAGATGAGCAAAAT 470

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  452  NM_167003.1  GlcAT-I CG32775-RA (GlcAT-I), mRNA 
NM_164672.2  CG9098-RB, transcript variant B (CG9098), mRNA 
NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
NM_132528.1  ATP7 CG1886-RA (ATP7), mRNA 
NM_079853.2  headcase CG15532-RA, transcript variant A (hdc), mRNA 
NM_176591.1  headcase CG15532-RC, transcript variant C (hdc), mRNA 
NM_170478.1  headcase CG15532-RB, transcript variant B (hdc), mRNA 
NM_001014507.1  lethal (2) 44DEa CG8732-RI, transcript variant I (l(2)44DEa), mRNA 
NM_080018.1  Tollo CG6890-RA (Tollo), mRNA 
NM_001014511.1  lethal (2) 44DEa CG8732-RE, transcript variant E (l(2)44DEa), mRNA 
NM_170615.1  lethal (2) 44DEa CG8732-RA, transcript variant A (l(2)44DEa), mRNA 
NM_143777.2  lethal (2) 44DEa CG8732-RB, transcript variant B (l(2)44DEa), mRNA 
NM_001014512.1  lethal (2) 44DEa CG8732-RD, transcript variant D (l(2)44DEa), mRNA 
NM_001014510.1  lethal (2) 44DEa CG8732-RF, transcript variant F (l(2)44DEa), mRNA 
NM_001014509.1  lethal (2) 44DEa CG8732-RG, transcript variant G (l(2)44DEa), mRNA 
NM_001014508.1  lethal (2) 44DEa CG8732-RH, transcript variant H (l(2)44DEa), mRNA 
NM_170616.1  lethal (2) 44DEa CG8732-RC, transcript variant C (l(2)44DEa), mRNA 
NM_170204.1  CG11844-RB, transcript variant B (CG11844), mRNA 
NM_170206.1  CG11844-RC, transcript variant C (CG11844), mRNA 
NM_170205.1  CG11844-RA, transcript variant A (CG11844), mRNA 
NM_139870.1  CG8541-RA (CG8541), mRNA 
NM_057700.3  Calpain-A CG7563-RA, transcript variant A (CalpA), mRNA 
NM_057699.3  Calpain-A CG7563-RB, transcript variant B (CalpA), mRNA 
NM_167396.1  lethal (1) G0007 CG32604-RB, transcript variant B (l(1)G0007), mRNA 
NM_132719.2  lethal (1) G0007 CG32604-RA, transcript variant A (l(1)G0007), mRNA 
NM_134931.2  CG31952-RA (CG31952), mRNA 
NM_080294.3  embryonic lethal, abnormal vision CG4262-RA, transcript variant A (elav), mRNA 
NM_001014713.1  embryonic lethal, abnormal vision CG4262-RB, transcript variant B (elav), mRNA 
NM_135615.2  CG6700-RA (CG6700), mRNA 
NM_139839.3  unc-13-4A CG32381-RA (unc-13-4A), mRNA 
100  482  NM_167003.1  GlcAT-I CG32775-RA (GlcAT-I), mRNA 
NM_140472.1  CG13466-RA (CG13466), mRNA 
NM_164430.2  CG31666-RD, transcript variant D (CG31666), mRNA 
NM_001038812.1  virus-induced RNA 1 CG31764-RD, transcript variant D (vir-1), mRNA 
NM_165010.2  virus-induced RNA 1 CG31764-RA, transcript variant A (vir-1), mRNA 
NM_165011.2  virus-induced RNA 1 CG31764-RB, transcript variant B (vir-1), mRNA 
NM_170184.1  slingshot CG6238-RB, transcript variant B (ssh), mRNA 
NM_079768.2  slingshot CG6238-RA, transcript variant A (ssh), mRNA 
10  NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
NM_176553.1  CG6129-RC, transcript variant C (CG6129), mRNA 
NM_144448.2  sallimus CG1915-RC, transcript variant C (sls), mRNA 
NM_142960.2  CG5463-RA (CG5463), mRNA 
NM_140368.1  CG11253-RA (CG11253), mRNA 
NM_170546.1  CG31005-RA (CG31005), mRNA 
NM_141764.1  CG4089-RA (CG4089), mRNA 
NM_079884.3  Zn finger homeodomain 2 CG1449-RA (zfh2), mRNA 
NM_078695.2  Rab-protein 10 CG17060-RA (Rab10), mRNA 
NM_137810.1  CG3290-RA (CG3290), mRNA 
NM_170275.1  scribbled CG5462-RA, transcript variant A (scrib), mRNA 
NM_001043296.1  scribbled CG5462-RG, transcript variant G (scrib), mRNA 
NM_170276.1  scribbled CG5462-RB, transcript variant B (scrib), mRNA 
NM_080015.2  scribbled CG5462-RD, transcript variant D (scrib), mRNA 
NM_057450.3  Neurotactin CG9704-RB, transcript variant B (Nrt), mRNA 
NM_168682.1  Neurotactin CG9704-RA, transcript variant A (Nrt), mRNA 
NM_140706.1  CG6497-RA (CG6497), mRNA 
11  NM_078604.3  highwire CG32592-RA (hiw), mRNA 
NR_001708.1  CR30009, miscRNA 
NM_079169.2  mitochondrial ribosomal protein S35 CG2101-RA (mRpS35), mRNA 
NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.